Плохо заводится на холодную гранта лада: вероятные причины и способы решения

вероятные причины и способы решения

Продукция отечественного автопрома хоть и прогрессирует в качестве и уровне исполнения, но все равно существенно отстает от западных аналогичных моделей. Поэтому ситуация, когда «Лада-Гранта» не заводится, довольно распространена среди владельцев. Если машина утром не завелась, не стоит отчаиваться. Мы рассмотрим типовые причины и расскажем, как решить проблему плохого запуска.

Стартер крутит, но двигатель не заводится

Если стартер после поворота ключа вращается, но мотор никак не хочет работать, то причин может быть достаточно.

Первая и наиболее очевидная – отсутствие топлива в баке автомобиля. Часто датчик уровня топлива врет даже на новых машинах. Стоит проверить уровень в баке и, если это необходимо, долить горючее. После этого можно пробовать заводить двигатель. Стоит также иметь в виду, что датчик уровня показывает неверное значение при низких температурах воздуха.

Аккумулятор

Стартер будет крутить двигатель даже с разряженной АКБ. А вот на создание искры энергии уже не будет. Первым делом следует проверить клеммы батареи – они могут быть окислены. Даже небольшой окисел на клеммах, незаметный глазу, может стать причиной плохого запуска. Подобное явление повышает сопротивление соединения. Проверить это очень легко – в том месте, где плохой контакт, будет повышаться температура.

Обычно рекомендуется проверять минусовую клемму аккумулятора, плюсовую клемму стартера, массы на двигателе. Если где-то окислен контакт, то соединение будет горячим. Скорее всего, «Лада-Гранта» не заводится именно поэтому.

Также может быть неисправна сама АКБ. Возможно, при замерах мультиметром батарея вполне исправна – мультиметр показывает нормальные напряжения. Но вот емкость аккумулятора снижена и энергии ее хватает, чтобы прокрутить стартер, да и на генерацию искры возможностей АКБ уже явно недостаточно.

Система питания

Третья причина – это различные неисправности, связанные с системой питания или управления двигателем. К примеру, если разгерметизировался какой-либо шланг или агрегат, вышел из строя топливный насос или регулятор давления, то двигатель не будет заводиться.

Здесь уже не обойтись без диагностики в СТО – необходима тщательнейшая проверка всех систем двигателя. Если обнаружена неисправность, следует заменить неисправную деталь или узел.

Система зажигания

Также стоит проверить, а есть ли искра. Если «Лада-Гранта» не заводится, то, как и в старинных карбюраторных моделях, либо нечему гореть, либо нечем поджигать. Если бензин есть, но машина не подает признаков жизни, тогда стоит проверить катушку зажигания и всю электрическую цепь, что обслуживает катушку. Возможно, где-то банально окислился контакт и это является причиной отсутствующей искры. После зачистки контакта она может появиться. Также если неисправна катушка, то ее следует заменить.

Все прочие причины, когда «Лада-Гранта» не заводится, связаны с самим мотором. Нередко на «Грантах» выходит из строя датчик положения коленчатого вала. Кроме того, проблемы могут быть в цепи этого датчика.

Стартер не работает

Как и в вышеописанном случае, причина может быть банальной. Это аккумуляторная батарея и контакты. Если стартер на машине не работает, не нужно идти в магазин и покупать новый. Возможно, где-то плохой контакт. Что проверять и как устранять, описано выше.

Еще одна причина, когда машина не работает после поворота ключа зажигания, может быть связана с замком зажигания, а точнее с контактной группой замка. Нередко там обгорают провода или окисляются контакты. Обычно такие элементы не поддаются ремонту, а для исправления ситуации достаточно установить заведомо исправную деталь замка.

Стартер

Если «Лада-Гранта» не заводится, стартер не вращается, то возможно проблема в нем. Здесь может быть множество разных интересных и не очень вариантов.

Стартер не крутится, если нарушен контакт, если износились щетки, замкнул статор или якорь. Также иногда причиной является неисправность втягивающего реле. Оно не способно замкнуть силовые контакты.

Первым делом стоит проверить всю электрическую цепь до стартера. Провода до него толстые, на первый взгляд вполне нормальные. Но внутри они состоят из массы тонких жил. Со временем провод может изнашиваться, перегорать. Нередко нарушается контакт в клеммах, которые опять же, на первый взгляд, выглядят вполне нормально. Если клемма до стартера окислилась, то найти место довольно просто – оно будет сильно нагреваться.

Провода подключаются к втягивающему реле, а контакты представляют собой медные болты. Медь сильно окисляется. И если качественного контакта нет, то стартер будет крутить, но двигатель вряд ли заведет. Следует зачистить эти болты на втягивающем реле, контакты проводов и попробовать запустить двигатель. Если стартер исправен, то автомобиль запустится.

Втягивающее реле

Бывает и так, что внезапно «Лада-Гранта» не заводится — щелкает втягивающее реле под капотом и ничего не происходит. То, что реле щелкает, уже само по себе хорошо – это значит, что щетки внутри стартера находятся в рабочем состоянии. Но щелчки могут говорить о севшем АКБ или неисправном втягивающем реле.

Втягивающее реле представляет собой электромагнит с двумя обмотками. Одна из них втягивающая, другая — удерживающая. Внутри также имеется медная пластина, которая замыкает контакты. Если контакты внутри реле подгоревшие, то увеличивается сопротивление. Стартер может совсем не крутить или работать так, как будто аккумулятор умер.

Если слышатся щелчки, но стартер не подает никаких признаков жизни, то требуется замена реле. Этот элемент ремонту практически не поддается. Корпус его завальцован и если его развальцевать, то при помощи обычного инструмента в гараже собрать реле уже не получится.

Щелчки втягивающего могут также говорить о том, что проблемы заключаются внутри стартера. Так, перегорают плюсовые провода, которые подключены к обмотке элемента. Также щелчки могут быть при замыкании обмотки на корпус. Для проверки придется снимать стартер, разбирать его и проверять мультиметром.

Маховик

Это достаточно редкая причина, но иногда она имеет место быть. Она заключается в том, что за время эксплуатации двигателя стерлись зубья на маховике. За них зацепляется бендикс стартера. Если зубья съедены, при запуске будут слышны характерные звуки, когда металл рвет металл. При этом «Лада-Гранта» не заводится, а стартер крутит. Устранить проблему можно при помощи замены зубчатого венца маховика.

Двигатель не заводится на холодную

Одна из самых популярных причин – это разряженный аккумулятор. Не хватает мощности стартеру, чтобы раскрутить коленчатый вал до нужных для запуска двигателя оборотов. Батарею нужно подзарядить, а если она вышла из строя, то заменить.

Также мотор не заводится на холодную, если нарушена герметичность в топливных форсунках. Необходима проверка этих элементов. При необходимости, неисправные детали нуждаются в замене.

Несмотря на то, что «Гранта» — автомобиль сравнительно новый, бывают проблемы с компрессией в камерах сгорания. В этом случае «Лада-Гранта» плохо заводится. Проверить это можно компрессометром. Этот прибор есть в большинстве автомагазинов. Если в каком-либо цилиндре компрессия меньше, чем нужно, необходимо выполнить ремонт двигателя.

Наиболее вероятная причина, хоть и не популярная – датчик температуры охлаждающей жидкости, который вышел из строя. Для проверки устанавливают заведомо исправный датчик.

Мотор не заводится на горячую

Если «Лада-Гранта» плохо заводится на горячую, то алгоритм действий полностью аналогичен алгоритму поиска неисправностей при попытках холодного пуска.

Первая причина – неправильная работа системы подачи топлива. В камерах сгорания может быть банально сухо, а без топлива, как известно, не заведется ни один двигатель.

Вторая причина – неисправный ДТОЖ. Также стоит проверить клеммы АКБ. Нередко их не затягивают так, как нужно, а просто надевают. В результате нет надежного контакта, а клеммы окисляются. Одна из оригинальных причин – засоренный воздушный фильтр.

Предохранитель прикуривателя

Вышеописанные причины универсальны. А теперь рассмотрим особенности конкретно «Лады-Гранты». У этого автомобиля есть некоторые интересные моменты. Одна из них приводит к тому, что машина «Лада-Гранта» не заводится. Это предохранитель прикуривателя. Он один для прикуривателя, звукового сигнала и иммобилайзера.

Этот нюанс знает не каждый автомобилист. Поэтому в случае, если машина не заводится, а все механические узлы исправны, стоит проверить именно этот предохранитель. Меняется он довольно просто. Поэтому решить проблему с невозможностью запуска можно за пару минут.

Иммобилайзер

Если при попытке запуска мотора на приборной панели мигает лампочка с символом ключика, то это говорит о реальных проблемах с иммобилайзером. Необходимо найти источник неисправности. В инструкции находится описание поломок, а также сигналов, которые подаются при поломке. Если не заводится «Лада-Гранта», причины могут быть как раз здесь.

Если запустить двигатель не получилось даже с пятого раза, тогда рекомендуется переобучить ключ. Но эта процедура требует определенных знаний и навыков. Поэтому подобную операцию лучше доверить специалистам из СТО.

Блок управления

Диагностировать вышеописанные проблемы легко. А вот в случае с выходом из строя ЭБУ ситуация сложнее. Обычно, если ЭБУ никто не трогал, оно работает без каких-либо нареканий. Но чаще случаются ситуации, когда блок заливается антифризом из-за его месторасположения.

Если не заводится двигатель «Лада-Гранта» и есть подозрения на ошибки ЭБУ, можно попробовать снять минусовую клемму АКБ на некоторое время. В результате сбросятся всевозможные ошибки. Зачастую, запустить мотор невозможно из-за ошибок CAN.

Простые поломки

Если «Лада-Гранта» крутит, но не заводится, то все может быть проблема не так уж и страшна. Возможно, неполадка вызвана тем, что свечи залило бензином, и они не могут генерировать искру. В основном свечи заливает зимой, так как компрессия превышает все нормы, и двигатель удается запустить не с первого раза. Проблемы со свечами возникают и при слабом аккумуляторе. АКБ не может обеспечить нормальной искры.

Продуваем свечи

Если машину никак не удалось запустить, да и из-под капота пахнет бензином, то можно попробовать продуть свечи зажигания.

Вообще, подобную операцию нужно делать сразу, а только потом проверять все остальное. Для просушки-продувки свечей достаточно нажать педаль газа до пола и покрутить двигатель стартером. Если двигатель не завелся, то придется выкручивать свечи и просушивать их.

Датчик коленчатого вала

Экзотическая проблема – выход из строя датчика коленвала. Его снимают и проверяют мультиметром в режиме вольтметра. Затем быстро двигают датчик перед его боковой часть металлической отверткой. Показатели на мультиметре должны измениться. Если все так, то датчик исправный. Также можно проверить сопротивление датчика. Нормальный результат – 750 Ом. В противном случае датчик нужно менять.

Топливо

Не стоит исключать качество топлива, если «Лада-Гранта» схватывает, но не заводится. Производитель рекомендует заливать в бак бензин А95. Но даже на нем у многих появляются проблемы. Большинство водителей с желанием сэкономить заправляются на недорогих не брендовых заправках, где часто заправщики заливают контрафактную продукцию. Нередко бензин разбавленный, его октановое число и другие характеристики не соответствуют нормам. Отсюда и проблемы с запуском.

Заключение

Если машина не хочет заводиться, нужно проверить АКБ, топливо, искру, свечи. Определенно не стоит беспокоиться. В большинстве случаев при отказе запуска поломки незначительные, и устранить их при должном опыте можно быстро и своими руками.

Лада Гранта не заводится: проблемы и решения

Однажды утром обнаруживается, что машина не заводится. Вы всего лишь оставили ее на улице в холодную ночь, разумно полагая, что если автомобилю от силы три месяца, то ничего страшного с ним не случится. Но утром приходит пора ехать на работу, а стартер не крутится, и бензонасос не включается, будто они никогда не были запитаны. Вы идете пешком, а вечером возвращаетесь, и авто заводится с первого раза, как будто ничего не произошло.

Возможные причины

Почему так происходит? Причин, почему Лада Гранта не заводится, может быть много, но в данном случае проблема в электрических контактах и разъемах, а именно в плохой массе на стартере. И это только один из симптомов.

После длительной стоянки нужно проверять уровень заряда аккумулятора, потому что с посаженной батареей не заведется не то что Гранта, но и любой другой автомобиль. Кроме того, проверяйте, хорошо ли сидят на аккумуляторе клеммы и в каком они состоянии. Если машине уже исполнилось 3 года, это уже срок для окисления проводов, поэтому электрике должно уделяться особое внимание.

Учтите, что в холодную погоду от заряда аккумулятора может остаться лишь третья часть. Так что надолго не бросайте автомобиль зимой на улице, не прикрыв его специальным чехлом (он бережет накопленное тепло), и чистите окислившиеся контакты, чтобы не пропало напряжение.

Возможно, Гранта не заводится из-за неисправности в топливной системе. Это часто случается, когда машина заводится и глохнет. Частая причина этого явления — перегорание топливного насоса. Для того чтобы проверить бензонасос, его снимают и подключают напрямую к аккумуляторной батарее. Если он после этого не заработает, значит, пора ставить новый. Также необходимо проверить топливные шланги на предмет обрыва или прокола. Для этого нужно всего лишь внимательно осмотреть днище машины. Нелишним будет проверить и топливный фильтр.

Сгоревшие свечи зажигания могут стать еще возможным поводом для того, что Лада не заведется. Обычно свечи загрязняются частицами топлива, если мотор долго работал на повышенных оборотах (например, при длительной езде с большой скоростью). Значит, за чистотой свечей надо следить, периодически выкручивая их и очищая чистой ветошью. Может помочь продувание камеры сгорания, которое делается следующим простым способом. Машина ставится на нейтральную передачу, втапливается педаль газа и включается зажигание, что вызывает большой приток воздуха в цилиндры.

И все равно не заводится

Засоренный воздушный фильтр может стать причиной неисправности

Машина так и не завелась? Проверьте воздушный фильтр. Скорее всего, он сильно засорен. Попробуйте его снять и снова запустить мотор. Запустился — выбрасывайте старый фильтр и ставьте новый. Ездить без него нельзя: в цилиндрах будет накапливаться сажа, и когда-нибудь двигатель перестанет нормально работать.

Еще возможная причина достаточно проста, но незаметна — перегорание предохранителей. Даже такая копеечная деталь может доставить неприятности, поэтому у каждого автолюбителя должен быть их запасной набор.

Возможно, что случился перегрев мотора, и поэтому он отказывается запускаться. Для того чтобы двигатель перегрелся, тоже есть несколько условий: поломка датчика температуры антифриза, выход из строя водяной помпы, недостаточный уровень охлаждающей жидкости. Помпу можно проверить подключением к аккумулятору, так же как и бензонасос.

В том случае, когда уровень охлаждающей жидкости станет ниже обычного, антифриз не поможет предотвратить перегрев мотора и в какой-то момент закипит. Охлаждающая жидкость также будет искать любую щель, чтобы вытечь наружу. Поэтому, если вы заметили около расширительного бачка странные подтеки, немедленно глушите мотор и обращайтесь в ближайший автосервис. Дальнейшая эксплуатация машины в данных условиях опасна и может привести ее в состояние, когда автомобиль невозможно будет отремонтировать.

Запуск двигателя зависит от стартера, который представляет собой специальный электромотор. Проверить его состояние можно подключением к аккумулятору.

Если машина не заводится, стартер не крутит, значит, возможен целый перечень неисправностей, от засорения клемм до поломки втягивающего реле.

Если стартер не в порядке, нужно обращаться к квалифицированным специалистам для его замены или ремонта.

На Гранте иногда достаточно часто возникают проблемы с датчиком положения коленчатого вала. ДПКВ позволяет блоку управления двигателем настраивать такты работы мотора, поэтому в случае его неисправности машина не заведется и загорится checkengine. Датчик может быть вполне исправным, но давать сбои из-за отходящих контактов или налипшей грязи, поэтому не заводится Лада Гранта.

Почистив датчик и проверив провода, можно решить проблему. Если это не помогло, поможет только автосервис, так как самостоятельная диагностика ДПКВ на Гранте сложна, отнимает много времени и может дать неправильный результат. Самому можно проверить расстояние между обмоткой и сердечником ДПКВ. Оно не должно быть больше миллиметра.

Неисправность реле может быть причиной того что автомобиль не заводится

Бывают случаи, когда Гранта со штатным иммобилайзером заводится с первого раза, потом глохнет, но все лампочки в салоне горят. Проблема заключается в том, что отпаивается микросхема в брелоке, без которого не завести машину. Нужно ее аккуратно припаять на место паяльником с небольшой мощностью и тонким жалом.

Если отходят контакты главного реле, бензонасос не будет включаться и Гранта не заведется. Часто в такой ситуации сразу начинают винить бензонасос, но в первую очередь нужно проверять контакты и предохранители.

Втягивающее реле на стартере может оказаться особенно коварным, первый запуск проходит на отлично, а потом мотор не заводится уже никак. Иногда помогает просто постучать по реле гаечным ключом, но потом все равно надо разобрать агрегат и тщательно осмотреть. А лучше приехать на СТО к грамотному механику.

Некоторые автовладельцы спрашивают, почему Гранта заводится не с первого раза. Это может произойти при неисправном регуляторе холостого хода. РХХ — это датчик, через который ЭБУ контролирует мотор, пока машина еще не движется. Симптомы его неисправности обычно такие: машина нормально заводится, но почти сразу падают обороты, а когда водитель нажимает на газ, двигатель глохнет.

Бывалые водители советуют в таких случаях проверять давление в топливной рампе и сетку на бензонасосе. Возможен и обрыв цепи питания топливной помпы. Если горит checkengine, вариантов может быть несколько, включая указанные выше, а низкое давление топлива необязательно будет препятствовать запуску мотора, но в процессе работы может случиться провал, либо двигатель заглохнет в движении.

Да, вы можете ехать и заглохнуть. Если это случилось, не паникуйте и не давите тормоз, надо по инерции съехать поближе к обочине или вовсе на нее, включить аварийку и в 100 метрах от машины, по направлению обратному вашему движению, поставить знак аварийной остановки. Если потребуется откатить машину в безопасное место или вы немного не дотянули до обочины, откройте дверцу, упритесь в левую стойку лобового стекла и рулевое колесо и катите автомобиль на обочину.

Руль нужно оставить разблокированным, повернув ключ в замке зажигания. Можно также подталкивать машину, одновременно поворачивая другой рукой левое переднее колесо. На руку для лучшего сцепления наденьте перчатку. Толкать машину таким способом легко даже не слишком физически сильному человеку.

Почему мотор остановился

Возможная из причин, по которой глохнет мотор в дороге — засорение дроссельной заслонки. Проблема решается ее чисткой. К остановке двигателя на ходу может привести и загрязнение топливного фильтра некачественным горючим. Иногда это проявляется лишь спустя длительное время после заправки. Решение только одно: слить плохой бензин и поменять фильтр.

Мотор заглох на ходу и не заводится? Скорее всего, сломался генератор или оборвался его приводной ремень. Когда это происходит, бортовая сеть не получает необходимого питания, аккумулятор садится и стартер уже не может крутиться.

Лада Гранта может не завестись из-за того, что во время стоянки остался включенным один из бортовых электроприборов, например, магнитола. Следите за этим, когда ставите автомобиль на длительную стоянку.

Заводим авто зимой

Зимний запуск — это отдельная тема. Сначала нужно просто включить зажигание. При этом автоматически включится ближний свет, держать его включенным нужно не менее 20 сек, затем выключите его, чтобы накопился пусковой заряд. Не включайте больше никаких приборов.

Включите нейтральную передачу и выжмите сцепление. Поверните ключ и слушайте стартер. Через несколько оборотов мотор должен завестись. Если этого не произошло, значит, пусковой заряд не достиг цели и нужно снова его накапливать. Если не получится и со второй попытки, значит, замерз аккумулятор. Остается два выхода: завестись от другой машины (так называемое прикуривание), либо нести аккумулятор домой на обогрев. На крайний случай остается еще попытка завестись на буксире, включив вторую передачу. На Гранте с автоматической коробкой передач этот способ не работает.

Прикуриваем правильно

«Прикуривание» еще один способ позволяющий завести авто

Проверенный водительским опытом способ запуска мотора в трудных ситуациях заключается в прикуривании, то есть в запитывании стартера от аккумулятора другого автомобиля.

Прежде всего, надо учесть, что провода для прикуривания должны иметь как можно большее сечение. Машины располагаются капотами друг к другу, но не соприкасаясь. Плюсовые клеммы обоих аккумуляторных батарей автомобилей соединяются одним проводом. Другой провод подводится на минус чужого аккумулятора, а вторым концом замыкается на массу.

Нельзя подводить провода к минусу севшего аккумулятора. Таким способом можно разве что зарядить аккумулятор, но не завести мотор, хотя в некоторых случаях и этого достаточно.

Если двигатель не запустился, на минусовую клемму севшего аккумулятора подведите крокодил напрямую от минуса рабочей батареи другого авто. Будьте осторожны, касание плюсового контакта вызовет короткое замыкание.

Запустившись, не спешите снимать провода, дайте двигателю некоторое время поработать. Запомните, снимается первым провод минуса, фары включать при этом нельзя, чтобы они не сгорели при скачке напряжения.

Что бы ни случилось, не впадайте в панику. Не заводится мотор Лады — ищите связанные с этим неисправности. Часть из них указана в руководстве по эксплуатации Лада Гранта. При любых затруднениях не медлите и отправляйтесь на СТО, особенно если машина еще на гарантии. Знайте, что есть проблемы, устранить которые может только профессионал. Не пытайтесь справиться с ними самостоятельно. Удачи!

Лада Гранта не заводится: причины, ремонт

Двигатель автомобиля – сложная система, состоящая из множества узлов и агрегатов, поэтому неудивительно, что время от времени какой-то из них выходит из строя – либо сам по себе, либо от воздействия внешних факторов. Одним из самых распространенных «симптомов» неисправности какого-либо механизма в двигателе является ситуация, когда автомобиль не хочет заводиться. Чаще всего такое происходит в зимнее время, например, когда на улице мороз, ветер, снегопад, или просто в холодную погоду.

Правда, знакомая ситуация? Вы садитесь утром в свою машину, поворачиваете ключ в замке зажигания, и вот сюрприз – стартер не крутит! Вы пытаетесь завести автомобиль еще раз и еще, и еще – однако ваша верная Лада Гранта всего лишь несколько раз «чихает» и глохнет. Как результат – вы опаздываете на работу, отменяете встречи, не можете выполнить другие запланированные на день дела, начинаете все больше и больше нервничать. На самом деле переживать нужно: есть шанс, что, обладая необходимыми знаниями и навыками, вы сможете найти причину того, что Лада Гранта заглохла, и попытаться устранить возможные неисправности. В большинстве случаев вам придется, скорее всего, воспользоваться услугами автосервиса, но почему бы сначала не попытать счастья самому?

Итак, Лада Гранта не заводится. Как действовать в таком случае? Прежде всего, надо понимать, что «не заводится» – понятие растяжимое.

Сначала нужно уяснить, как именно «не заводится» ваш автомобиль и оценить условия, при которых это происходит. Здесь возможны пять различных ситуаций:

  • стартер крутит, но двигатель не заводится;
  • стартер изначально не крутит вообще;
  • автомобиль заводится, но двигатель сразу глохнет;
  • не заводится холодный двигатель;
  • машина не заводится «на горячую».

Рассмотрим каждый из вариантов подробнее.

Машина не заводится, если стартер крутит

Причин тому может быть несколько.

  1. Первая и самая очевидна причина – в баке автомобиля попросту кончился бензин. Проверьте его уровень, заправьтесь и попробуйте завести машину еще раз. Имейте в виду, что при низких температурах датчик уровня топлива может отображать информацию некорректно.
  2. Вторая причина – разряд или неисправность аккумуляторной батареи. Посмотрите на датчик, проверьте, не окислены ли клеммы аккумулятора, хорошо ли затянуты. Если дело в клеммах – их следует зачистить или затянуть. Если в самой батарее – зарядите ее. При самом «невезучем» варианте – АКБ в вашем автомобиле требует замены.
  3. Неисправность в системе управления и питания двигателя – третья причина. Например, разгерметизация какого-либо шланга или агрегата, выход из строя бензонасоса или регулятора давления. Здесь уже без автосервиса, скорее всего, не обойтись – понадобится тщательная проверка системы с последующей заменой неисправной детали.
  4. Четвертую причину следует искать в электрической цепи, обслуживающей катушки зажигания. Найдя неисправность после проверки, замените нерабочую катушку.
  5. Остальные причины связаны непосредственно с двигателем. Может произойти поломка датчика положения коленчатого вала или его цепи, либо же разрыв ремня газораспределительного механизма. В любом случае все это «лечится» только заменой неисправного агрегата.

Стартер не работает изначально

Основные неисправности при такой ситуации:

  1. Как и в предыдущем варианте, причиной могут быть все указанные в пункте 2 неполадки с аккумулятором. Способы их устранения – такие же.
  2. Второй причиной порой выступает неисправность замка зажигания. Необязательно сразу вызывать автомеханика – обычная проверка и визуальный осмотр могут помочь сразу выявить причину, которую, при необходимости, можно попробовать устранить самостоятельно.
  3. При третьей причине неисправность следует искать в тяговом реле или в электродвигателе стартера. Так, могут быть неисправны обмотки стартера, якорь или щетки. Здесь зачастую при проверке и ремонте без профессиональной помощи уже не обойтись.
  4. Четвертая причина – возможные неполадки в электрической цепи или приводе стартера. Следует проверить последовательно все детали. Если есть необходимость – заменить вышедший из строя элемент.
  5. Последняя причина – сильный износ или повреждение зубцов маховика. Такое случается достаточно редко. Решение проблемы – только замена маховика на новый.

Двигатель сразу глохнет

Нередко бывают ситуации, когда автомобиль заводится с первого раза, но постоянно глохнет. В таких случаях ключевых причин четыре:

  1. Первой причиной могут стать неполадки в катушках зажигания. Необходимо осмотреть все электрические соединения – там не исключены повреждения либо же они просто ослабли. Неисправность устраняется заменой вышедшей из строя детали.
  2. Причина номер два: низкое давление в топливной системе двигателя. В этом случае диагностировать и ремонтировать нужно ее. Процесс, к сожалению, может быть трудоемким и оказаться доступным только в автосервисе.
  3. В третьем случае наблюдается разгерметизация в соединениях узлов впускного тракта автомобиля. Следует осуществить проверку трубопровода, ресивера и каталитического коллектора, устранить поломку.
  4. Четвертый вариант – неисправность системы управления двигателя в целом либо отдельных ее агрегатов. Здесь поможет только диагностика у специалистов.

Не заводится холодный двигатель

Чтобы помочь вашему железному коню завестись, обратите внимание на следующие причины:

  1. Первая причина – разряд АКБ и, как результат, недостаточная скорость вращения коленчатого вала. Здесь все ясно: аккумуляторная батарея требует подзарядки или замены.
  2. Второй фактор – отсутствие герметичности в форсунках системы подачи топлива. В таком случае нужно осуществить проверку форсунок и при необходимости заменить их.
  3. Третьей причиной может быть недостаточная компрессия в цилиндрах двигателя. Тогда следует осуществить проверку компрессии и отрегулировать ее. Для этого существует специальная пошаговая последовательность действий, которая не является предметом данной статьи.
  4. Четвертая причина достаточно глобальна – любая неисправность в топливной системе автомобиля, либо же в системе управления двигателем, кроме вышеуказанных двух. Выход тут один – диагностировать, диагностировать и еще раз диагностировать! Конечно же, профессионально.
  5. Последняя вероятная причина, хотя и довольно нечастая – выход из строя ДТОЖ (датчика температуры охлаждающей жидкости). Поможет исключительно замена датчика.

Двигатель не заводится «на горячую»

Процесс выявления и устранения неисправностей при такой оказии во многом пересекается с алгоритмом действий при холодном двигателе.

  1. Причина номер один – некорректная работа системы подачи топлива (см. пункт 4 предыдущего раздела).
  2. Причина номер два – неисправность датчика температуры ОЖ (см. пункт 5 предыдущего раздела).
  3. Причина номер три – неполное затягивание клемм аккумуляторной батареи или их окисление (см. пункт 1 предыдущего раздела).
  4. «Оригинальной» причиной может быть засорение воздушного фильтра двигателя. В таком случае агрегат следует заменить на новый.

Материалы: http://ladaautos.ru/lada-granta/chto-delat-esli-lada-granta-ne-zavoditsya-i-kak-pochinit.html

Сейчас тоже протянули массу, подтяули крепление стартера, но это не помогло.

Интересная особенность. С утра в мороз заводится с первого раза. Но стоит проехаться и заглушить мотор, может не завестить. Подождешь минут пять десять — заводится. При плюсовой температуре этой проблемы нет.

Выкладываю видео с мобильника:

Может это втягивающее?

Снял сейчас показания аккумулятора:

В режиме покоя: 12,78

После того как завести, включения печки на 1ю скорость и включения габаритов:14,32

При включенном зажигании, включенной печке на 1й и габаритах:12,1

щас звонил в сервис где ТО проходил говорят акум смотри сел . хотя . (((((..у меня в гараже стоит без сиги .значиг акум говно ((((. на калине вон три года и ничего акуму (((

щас звонил в сервис где ТО проходил говорят акум смотри сел . хотя . (((((..у меня в гараже стоит без сиги .значиг акум говно ((((. на калине вон три года и ничего акуму (((

Панель мафона посадит батарею за неделю если аккумулятор умер. Но вот зачем такая зарядка не понял, да и как вы добились такой точности тока, а напряжение какое было? Напряжение в начале зарядки и после очень интересно.

А автору темы надо зарядить аккумулятор и попробовать завести авто.

Да и пора налаживать тропу к гарантийщикам. Если после зарядки авто запустица, утечки и потребителей включеных не было, то тут один диагноз, батарею на помойку

У меня за три дня стоянки в теплом гараже сдох. Померял ток утечки с панелью 200-210мА, без 35-38мА. Пионер DEH 4400.

Но вот зачем такая зарядка не понял, да и как вы добились такой точности тока, а напряжение какое было? Напряжение в начале зарядки и после очень интересно.

Сначала заряжал током 5А. Зарядник полуавтомат. Когда ток упал на ноль напряжение было 14.7 В, плотность поднялась с 1.1 до 1.18. После этого выставил 1.5А и заряжал две недели, напруга была 14.7. Полуавтомат все время отключался-включался (стрелка амперметра прыгала с 0 на 1.5А) Постепенно плотность стала 1.24. когда перестала подыматься-менятся прекратил танцы)))

Проще и правильнее купить новый.

Да и живет батарея года три, редко когда дольше протягивает

Оставил, больше такой проблемы нет. Аккумулятор Саратовский, вроде.

Было у меня когда покупал прошлую машину, на моей стартер не крутила. Рядом «07» стояла, с неё переставили «АКОМ» 55, верой служил 6 лет потом. На том что не завелась стоял АКТЕХ. А гарантийный талон так и остался на АКТЕХ.

Если стоит БК Штат, то его вина 100%

А сколько данная приблуда потребляет токУ?

Купил сегодня кнопку, вместо заглушки подогрева поставлю и буду питание отключать на комп, цена вопроса 70 р.

Возможно жена магнитолу не выключила (осталась на паузе или MUTE).

Некоторые магнитолы даже если выкл. продолжают жрать не по-детски, пока не снимешь панельку.

На ЛГ магнитола подключается к аккуму, минуя замок зажигания.

Если кому не сложно поделиться информацией, прошу подскажите мне пару вещей. Так вот я описываю систему пуска ваз 2190 (но не имея этой машины), можете подсказать какой установлен на «Гранте» стартер (его модель) я вроде бы нашел но он ли это? вот ссылка http://www.autosecret.net/lada-granta-v . ada-granta.

еще мне надо предоставить полное описание всех составлявших этого стартера и роботу планетарного механизма (мне желательно даже инф. сколько обмоток в тяговом реле или сколько зубцов в на шестернях в планетарном механизме и т.д.)

какая стоит коммутирую шея аппаратура.

Кто предоставит инф. или подскажет где искать буду очень благодарен.

П.С. если что извенити за правописание, так как я с Украины

ездил заводилась,остановился заглушил через 5 минут больше не завелась

Как обычно сел в машину, ключ в зажигание, насос как обычно подкачал, делаю поворот

Вал вращается, но схватиться движок не может, раз 5 пробовал, ни в какую не схватывает

никакой попытки, выкрутил свечу, снова завожу, искры на ней нет.

но не знаю как её полностью отключить, нашёл разве что, при включении зажигания — нажать 3 раза валет кнопку, и выключить зажигания, мол сигналка отключится, но не помогло

Реле блокировки сигналки как правило должно быть настроено на замыкание в рабочем состоянии, при его неисправности завести нельзя. Может и модуль зажигания отказал, хотя отказ обоих катушек у него маловероятен, должен схватывать.Если нет навыков в электричестве обращайтесь в сервисный центр по гарантии. Иммо активирован?

в результате, снял его почистил (протёр т.е. =)))) ) взял тестер померял напряжение и сопротивление — всё показывает, всё измеряет…хм :/

Cегодня у друга, такая же проблема, снятие клеймы — не помогло, — выкатили с паркинга, на эвакуатор и к диллеру, там клейму сняли — подождали, завелась .

Что то косяк какой то с автоматами . нужно срочно искать таблетку.

Или ошибка где то накапливается или помехи электромагнитные.

Еще вопрос — иммо активирован?

Выезжать, а она не заводится, Вытолкали, клемму скинули — все, проснулась, завелась .

ЗЫ: диагностика в сервис центре — ни чего не показала, — сказали, что он не первый.

Ваще бардак. В городе полно дилеров, дозвонится получилось только до одного. У остальных праздники. Особый привет Июлю и АМК, ближайшие от меня салоны и такое кидалово. В техподдержке Лады ваще конченные дуры работают, насоветовали звонить в другой областной город, раз местные недоступны. и ипитись как хотите. Вспоминается, сервис у иномарок, звонок на 8800******, и те сами вызывают эвакуатор и везут в ближайший сервис. Это как пример.

далее в этот же день, то есть сегодня опять скончалась в автомойке, на месте снова сброс клемм не помог. отогнал, скинул, завелась.

Мастер в сервисе предположил, что косяк из за активированного иммо. ППЦ.

вообщем похоже нашли проблемку у нашего варианта, потестим месяц и если диагноз подтвердится, — озвучим.

Чо еще произошло. На 900 км появился страааный свист. Едешь разгоняешься, отпускаешь газ, авто катиться и начинается Свист, как троллейбус при торможении вжжжууууу. От высокого к низкому. Вот по ощущениям, как будто я не АКПП а на МКПП еду, и понишенную включаю, и мееедленно сцепление отпускаю и движка подвывает с коробкой.

РЕжим АКПП не влияет, даже в N ставил накатом. Все равно свистит в движении при отпускании газза пока до 10 км/ч не снизится.

На сервис сгонял, ошибку считали, там короче что то с коробкой, какой то датчик выдал ошибку (мне назвали, я не зщапомнил блин. сбросили ошибку. Пока делать ни чо не стали, нет рекомендаций от ВАЗа по данному вопросу если все работает исправно, Буду наблюдать за авто.

появилась пару месяцев назад. Последние две недели появлялась через день. Снятие клеммы не помогало. У дилера в «Питер-Ладе» в первой смене разводили руками и ни чего не хотели делать. Принял решение последний раз заехать в «Питер-Ладу», но в работу другой смены. Заехал в 9:00, оставил им машину, позвонили в 18:30 приезжайте забирайте. Как причину неисправности, озвучили хреновую «массу». Зачистили, протянули. Вообщем поезжу посмотрю, хотелось бы верить, что проблема ушла.

Тойота — управляй мечтой! ВАЗ — не с_ы, доедем.

Покатался, буду наблюдать.

Очень может быть.

Сегодня двигался из пункта А в пункт Б, после чего стоял на заведенной машине, во время простоя загорелся чек, списав все на плохой бензин, решил поехать обратно в пункт А и тут началось. Первое, что я заметил это реакция педали газа на нажатие, давишь в пол, а машина еле-еле набирает обороты, далее по прошествии некоторого времени, она вообще перестала реагировать на нажатие, в дальнейшем заметил что стрелка оборотов на 0 причем с непонятной периодичностью она прыгает к 1, а потом опять в 0, двигатель при этом работает ровно. Далее события развивались еще хуже, пропал чек, загорелся иммобилайзер и машина перестала заводиться, при чем не крутится стартер и не шумит бензонасос. Очень прошу помощи.

и проверте напряжение.

ошибки бы прочитать .

что то сдохло и двигатель перешел в аварийный режим — позволял ехать какое то время — теперь не дает запуститься . посмотреть разъемы, но лучше почитать ошибку, стрельнуть у когонить овдэшку у знакомых или бк .

у вас похоже проблема с комбинацией приборов или эбу.

панель вообще себя вела странно,

Да, но после этого случая говорит что его не активировали.

Пятой точкой чую, что это ЭБУ, потому-что все произошло после сильного ливня и по описаниям других владельцев все сходится. Как вы думаете, можно ли это списать на гарантийный случай, на ТО машину не гонял ни разу. Если с гарантией не прокатит, то где можно заказать мозги, город Санкт-Петербург. Спасибо всем за помощь!

Пятой точкой чую, что это ЭБУ, потому-что все произошло после сильного ливня и по описаниям других владельцев все сходится. Как вы думаете, можно ли это списать на гарантийный случай, на ТО машину не гонял ни разу. Если с гарантией не прокатит, то где можно заказать мозги, город Санкт-Петербург. Спасибо всем за помощь!

Пятой точкой чую, что это ЭБУ, потому-что все произошло после сильного ливня и по описаниям других владельцев все сходится. Как вы думаете, можно ли это списать на гарантийный случай, на ТО машину не гонял ни разу. Если с гарантией не прокатит, то где можно заказать мозги, город Санкт-Петербург. Спасибо всем за помощь!

Проверяйте катушку зажигания, похоже на пробой от влаги и вследствие чего смерть ЭБУ.

Двигатель не колбасило?

Вобще по идее это гарантийный случай. Если откажут везите блок к электрику, на работе так двенашку недавно вылечили. Электрик что то перепаял и всё, благо там выгорает совсем чуть чуть.

Двигатель не колбасило?

Вобще по идее это гарантийный случай. Если откажут везите блок к электрику, на работе так двенашку недавно вылечили. Электрик что то перепаял и всё, благо там выгорает совсем чуть чуть.

Обязательно, дам знать чем закончилась история.

Во время сильного ливня прямо на дороге машина неожиданно заглохла.

Стали сами закрываться и открываться стёкла, звуки странные из-под приборки стали возникать.

Снятие клеммы, дёрганье предохранителей не помогали. Машина не заводилась, стартер не крутит, горит значёк иммобилайзера (машинка с ключиком).

Примерно через минут 40 все глюки пропали, машина завелась.

Остался гореть джекичан.

Во время сильного ливня прямо на дороге машина неожиданно заглохла.

Стали сами закрываться и открываться стёкла, звуки странные из-под приборки стали возникать.

Снятие клеммы, дёрганье предохранителей не помогали. Машина не заводилась, стартер не крутит, горит значёк иммобилайзера (машинка с ключиком).

Примерно через минут 40 все глюки пропали, машина завелась.

Остался гореть джекичан.

С резинкой все в порядке, подозреваю что это воздухозаборник печки, он располагается перед пассажирским местом снаружи, вода не пройдя по стокам попала в нее, как я понял там же находится и салонный фильтр, но могу ошибаться.

У меня иммо не активирован, машинка загорается секунд на 5-6 после заводки и гаснет. Но не мигает.

Провод до ДПКВ, случаем не поджарился на катаколлекторе?

Материалы: http://www. lada-granta.net/archive/index.php?t-6291.html

Когда мы проводили тест-драйв новой Лады Гранты, сюрприз поджидал уже при опробовании дополнительного брелка сигнализации. Вопреки уверениям сотрудников автосалона, при первом нажатии на кнопку брелока мы обнаружили, что Лада Гранта не заводится. Только с третьей попытки двигатель Лады завелся. Однако здесь претензий к АвтоВАЗу нет, скорее к установщикам дополнительного оборудования. Так как дистанционный запуск с помощью сигнализации относится к опциям не заводского характера.

В машине, комплектации «Норма», было все оборудование, заявленное в рекламной компании. Салон радует мягким креслом, регулируемым по углу наклона спинки продольно, что делает его не особо удобным. Так же салон оснащен бортовым компьютером с фирменным сенсорным дисплеем с навигацией и дополнительной магнитолой. Регулировка руля возможна лишь по высоте, что заставляет приводить спинку почти в вертикальное положение, чтобы не было необходимости тянуться к рулю.

Автомобиль оказался довольно резвым, если сравнить его с Рено Сандеро, то можно сказать, что иномарка с теми же параметрами двигателя едет гораздо слабее. И что радует, тяга мотора распределена равномерно по всему диапазону рабочих оборотов, без скачков. Восьмиклапанный мотор теперь развивает 90 л. с., благодаря облегченным поршням и шатунам.

Тормоза не показали должного уровня. При экстренном, резком торможении выяснилось, что свободный ход у педали тормоза очень длинный, а эффективность нажатия достаточно мала. Педаль только тяжелеет, но толку мало. Таким образом, тормоз требует нажатия обеими ногами сразу.

Но настройки подвески показали себя очень хорошо. Стойки амортизаторов работают очень мягко.

Печка быстро справляется с нагревом салона, но направление обдува изменяется с усилием, а то и с хлопком, это зависит от положения заслонки. Зеркала регулируются вручную, а электростеклоподъемники не до конца опускают стекла. Кондиционер в машине не предусмотрен.

Багажник новой Гранты очень велик. Место найдется и для запаски и для набора автомобилиста и для вещей для пикника или поездки.

Но заднее сиденье не порадует ни владельца, ни его пассажиров. Спинка дивана сплошная, что вызывает определенные трудности при попытке ее сложить, так как по краям дивана есть два фиксатора, на которые нужно нажимать одновременно. Пассажирам же не хватит места для ступней.

купил 2013 02 норму недостаток нет натяжителя ремня генератора сейчас делают

гранта прострная машина я вешу с 110 и мой друг 110 и мы сидим свободно с переди а взади токиеже как мы и всем места выше крыше

подскажите …завожу машину включаю свет мотор глохнет.авто гранта.

Лада гранта.автомат.вечером поставила машину,на утро не заводится почему. что делать.

Взял гранту механика 13 года поехал на ходу зоглох движок всё работает а не заводится свечи тоже впоряде подскажите в чём дело

  • Где купить Ладу Гранту в Москве?Где купить Ладу Гранту в Санкт-Петербурге?
  • Лада Гранта Люкс
  • Нет записей.

еще фото.

Материалы: http://avto-granta.ru/remont-i-obsluzhivanie-lady-granty/ne-zavoditsya-lada-granta

Лада калина плохо заводится на холодную причина


Лада Калина плохо заводится на холодную причина

Наш материал посвящен одной из распространенных проблем – это трудности с пуском мотора в отечественной малолитражке Лада Калина.

Если при первой попытке двигатель в Лада Калина, которая 8 клапанная отказывается запускаться, то это свидетельствует о присутствии некоторой проблемы. Причины такого «поведения», как плохо заводится на холодную разнообразные, поэтому сосредоточимся на основных и распространенных факторах, вызывающих данную неприятную ситуацию.

Итак, причины неуверенного запуска или его отсутствия:

  1. Недостаточный уровень давления топлива в рампе системы впрыска. При длительном простое авто давление внутри рампы склонно понижаться и тогда плохо заводится на холодную. Для безупречного запуска двигателя требуется стабильная работа топливного насоса, что позволяет обеспечить рабочее значение давления. Когда нанос частично изношен или засорен фильтр топливной системы, то с первого раза запустить силовой агрегат вряд ли удастся. При повторном пуске нанос создает достаточный уровень давления, необходимый для подачи требуемого объема смеси внутрь камер, и двигатель начинает функционировать. И это далеко не все причины данной проблемы.
  2. Пришла в негодность катушка зажигания. Эта проблема характерна не только для 8-клапанных версий моторов LADA Kalina, но и для их 16-клапанных собратьев. При недостаточном функционале катушки пуск движка с первой попытки также маловероятен. Отчетливо данная неисправность проявляет себя при сырой погоде или в морозный период, как раз плохо заводится на холодную.
  3. Неисправен датчик положения коленвала. Такая поломка случается весьма редко, однако при ее появлении мотор не заведется ввиду отсутствия искры.
  4. Вышел из строя регулятор холостого хода (РХХ) или датчик положения дроссельной заслонки (ДПДЗ). Если присутствует неисправность указанных электронных компонентов системы впуска, то мотор LADA Kalina также будет нестабильно запускаться. Не в каждом случае на помощь сможет прийти бортовой контроллер в виде отображения факта поломки на мониторе. Эффективным методом выявления дефекта станет замена обозначенных «подозреваемых» на заведомо исправные аналоги.
  5. Бензин с недостаточным качеством. Это довольно распространенная причина, побуждающая мотор неуверенно заводиться, частая причина, когда плохо заводится на холодную. Здесь потребуется сменить поставщика топлива (АЗС) и затем сделать определенные выводы по изменившемуся поведению машины.
  6. Запуск движка заблокирован иммобилайзером. Многие владельцы Лада Калина, если она 8 клапанная, осведомлены о данной проблеме, а некоторые уже успели повстречаться с ней воочию. Иногда помогает переобучение ключа. Если результат отсутствует, то понадобится отключение охранной системы или ее ремонт. При недостаточном опыте рекомендуем обращаться к мастерам.

Подведем итоги

Причины неудовлетворительного запуска силовой установки, как уже говорилось, весьма разнообразные. Мы привели наиболее распространенные и дали рекомендации, как ликвидировать некоторые из них. Если вы обладатели Лада Калина, у которой 8 клапанная силовая установка, столкнулись с данной проблемой, напишите об этом в комментарии. Отзыв будет полезен, особенно если в нем присутствует пример нестандартного решения проблемного пуска агрегата.

На Гранту седан спойлер

Lada Granta краш тест

vaz-lada-granta.com

Калина плохо заводится утром. — Лада Калина Универсал, 1.6 л., 2012 года на DRIVE2

Когда покупал машину, заметил сразу что плавают обороты на ХХ.Так как машина в целом очень хорошая и недорого, решил брать с этой проблемой. По трассе идет хорошо, на оборотах работает нормально.Теперь внимание!Машина 1.6 8 кл. Е-ГАЗ. пробег 60 тыщ.

Утром заводится с 3-4 раза. Заводится и глохнет. потом газ нажму вроде нормально.

ДТОЖ, СВЕЧИ, ПРОВОДА, новые.Если завелась и поработала немного то заводится потом нормально, но стартер все равно крутит 2-3 оборота.

На холостом ходу работает не ровно!

Подключил ЕЛМ-327 — проскакивают пропуски зажигания. то в 1, то в 2, то в 3, то в 4. Но больше в 1 цилиндре…Прогрел машину до 90 градусов, и пропуски почти что пропали. Ну проскочит один-другой, раз в 3-5 минут.Если температура 60-70 градусов, то пропуски постоянно мелькают.Что делать? Это клапана?

Датчика распредвала на этой машине нет. Давление в топливной рампе не мерил.

Дополнение!почистил форсунки и ДУ. форсунки продули жидкостью АБРО для чистки карбюраторов.Дроссель снял и весь облил этой жидкостью. блестит как у кота одно место)Итог. Заводится стала с первого раза, но крутит все равно секунды две примерно,подсказали что это особенность егаза -нет датчика фаз и из-за этого дольше крутит.

пропусков стало гораздо меньше, но они остались. Буду повторно чистить форсунки, когда потеплеет. Так что можно сказать проблема решена.

www.drive2.ru

Плохо Заводится На Холодную Калина 8 Клапанная

Почему Лада Калина заводится не с первого раза: диагностика

Большинство автолюбителей сталкивались с неувязкой, когда Лада Калина заводится не с первого раза. Этому служат различные предпосылки, которые следует знать и впору устранять. Здесь разглядим главные предпосылки того, что машина заводится не с первого раза и способы устранения этих дефектов.

Главные предпосылки

Движок заводится не с первого раза

У Калины достаточно всераспространенная причина того, что она не заводится с первого раза. Это связано с конструкцией, износом и электрикой. Однако, стоит разбить трудности на категории и разглядеть их детальнее. Что нужно, разглядим главные категории, на которые делится эта неисправность:

  • Неувязка с топливной системой.
  • Причина в зажигании.
  • Поломка частей ГРМ.
  • Неувязка в работах электроцепей и ЭБУ.

Когда что остается сделать нашему клиенту разобрано на предпосылки, стоит разглядеть их более деталь что изначально, как убрать их на автомобиле.

Топливная система

Первой предпосылкой того, что автомобиль может, не заводится с первого раза, становится топливная система. Недостающее количество горючего либо очень большая подача бензина становится неувязкой. Тогда стартер крутит, увы пуск затруднён. Если стартер не крутит и мигает значок иммобилайзера, то неувязка уже не знакомых иммобилайзера.

Износ топливного насоса

Поломка бензонасоса либо засоренность топливного фильтра бывают вариации послужить тому, что давление в топливной магистрали недостающее и смесь выходит бедная. Соответственно маленькое количество горючего в камерах сгорания недостаточно для запуска мотора. Когда подается очень много топливной консистенции, то свечки зажигания просто закидывает и нет искры для воспламенения, что служит предпосылкой не пуска мотора.

Зажигание

2-ой предпосылкой отвратительного запуска служит неисправность бухгалтерской системы зажигания. Неувязка может крыться в последующих узлах:

  • Неисправность замка зажигания.
  • Пробой в высоковольтных проводах.
  • Износ свеч либо их загрязненность.

При рассмотрении трудности нужно, обратить внимание в первую очередь на свечки, очистить их и отрегулировать зазоры используя щупа.

Машина плохо заводится на прохладную. Калина. Приора. Гранта. 2110. Помним подписываться на канал

Машина плохо заводилась после долгой стоянки. Неувязка была в одном из датчиков, при выходи из строя которо.

Почему плохо заводится инжектор

Машина плохо заводится на прохладную и троит LADA Kalina. LADA 2110, 2112, 2114, 2115. Неувязка нашлась!

Дальше, нужно проверить провода зажигания, сопротивление и наличие повреждение изоляции. При желании стоит поменять сломавшиеся изделия.

Износ либо повреждение высоковольтных проводок сопровождается нехорошим сопротивлением

Газораспределительный механизм

Не один раз в мануалах встречаются, что пуск не с первого раза связан с неверной работой газораспределительного механизма. Изначально, это связано с нагаром, который появляется на клапанах, и дополнительно неправильной работой фаз рассредотачивания газов. Неисправность стоит находить в распределительных валах, и конечно положении коленчатого вала относительно распредвала.

Очередной предпосылкой будет служить износ ремня и ролика ГРМ. Растянутый ремень может нарушить фазы газораспределения. Стоит проверить и при желании установить новый ремкомплект ГРМ.

Правильный монтаж меток ГРМ, если оно не соответствует рисунку, то это причина отвратительного запуска мотора

Электрика

Последней предпосылкой, почему возникает такая неисправность становится электронные детали и цепи. Так, неувязка может крыться в стартере, электрическом блоке управления либо проводке. Откидываем основную причину АКБ, так как если он сел, то автомобиль и со второго раза не заведется. Разглядим что остается сделать нашему клиенту предпосылки по раздельности.

Стартер

Задачи в работах и выходе из строя частей этого узла бывает предпосылкой отвратительного запуска.

Так, поломка втягивающего реле либо бендикса бывает предпосылкой того, что Калина не будет заводиться с первого раза. Также, стоит проверить провода, которые быть окисляться и пропускать контакты через один раз.

Проводка

Пробои и задачи в проводке бывают вариации послужить предпосылкой того, что автомобиль не с первого раза будет заводиться. Так, стоит находить делему меж клеммами аккума и стартером, а кроме того катушкой зажигания и свечками.

Нагар на свечках прослужит предпосылкой отвратительного запуска мотора

Электрический блок управления бывает основной предпосылкой того, что автомобиль не желает заводиться с первого раза. Так, множество ошибок, приводит к выдаче неправильных команд. К примеру, неверное количество распределяемого горючего либо обогащение консистенции. В ЭБУ стоит лезть если испытанная топливная система, зажигание и стартер. Устраняется причина обнулением ошибок либо сменой прошивки.

Ошибки электрического блока управления

Вывод

Таким макаром, Лада Калина не заводиться с первого раза по нескольким причинам. Главные там – это поломка топливной комплекса бухгалтерских программ, ошибки в электрическом блоке управления по другому поломке стартера. Некие автовладельцы отмечают, что бывают случаи, когда таковой эффект появляется вследствие износа обода маховика. Всегда, если автомобилист не уверен о том, что сумеет совладать с неисправностью без помощи других, то стоит обратиться к спецам на автосервис.

sis26.ru

Плохо заводится и глохнет на холодную Лада Калина

Автомобиль: Лада Калина, 2008 год. Спрашивает: Аноним. Суть вопроса: плохо заводится на холодную?

На холодную плохо заводится, заведётся обороты резко возрастают затем глохнет, чек не горит. Прогретая работает идеально. ДПДЗ и РХХ заменены.

Содержание

  • 1 ДМРВ как проблемное место плохого старта двигателя

ДМРВ как проблемное место плохого старта двигателя

Скорее всего глючит датчик массового расхода воздуха. Если ДПДЗ и РХХ заменены, и вы уверены в их работоспособности, то больше вариантов нет. Лучше всего посмотреть параметры ДМРВ при запуске на холодную, что он выдаёт.

Ваши симптомы похожи на не верные показания именно этого датчика.

ДМРВ Лада Калина вблизи

ДМРВ — один из самых дорогих датчиков в автомобиле.

ЭБУ

Если ДМРВ исправен, то виной подсос воздуха или ЭБУ.

carfrance.ru

Полезные модификации лады гранты своими руками. Тюнинг лады гранты

Тюнинг Гранты своими руками – довольно спорная тема как среди специалистов, так и среди любителей. С одной стороны, автомобиль отлично подходит для повседневного использования, и пытаться что-то улучшить в нем означает «ловить» и другие элементы. С другой стороны, каждый хочет модернизировать свой автомобиль, несмотря на возможные трудности и затраты.

1

Тюнинг Lada Granta Sport, как правило, подразумевает увеличение мощности и увеличение крутящего момента двигателя автомобиля.В этом случае владельцу отечественной модели следует перешлифовать каналы ресивера. Зачем это делать? Внутренняя конструкция впускного коллектора автомобилей ВАЗ имеет ряд дефектов. Кроме того, на стыке коллектора и ресивера, а также на стыке ГБЦ и коллектора имеются «ступеньки». Плюс сама внутренняя поверхность ресиверных каналов далека от идеала – шероховатая и не совсем ровная. В совокупности эти дефекты препятствуют полному наполнению цилиндров, что, в свою очередь, снижает мощность машины.

Самостоятельное шлифование каналов

При комплексном тюнинге верхней части двигателя Grant Sport необходимо модифицировать как впускные, так и выпускные каналы. С каналами выпуска дело обстоит немного проще – вполне достаточно ревизии ГБЦ, о которой мы поговорим ниже. Для модернизации впускных каналов потребуется сделать – купить и установить прямоточную систему увеличенного диаметра. Но так как такая конструкция достаточно дорогая, то эту часть тюнинга обычно пропускают.Существует множество методов доработки ГБЦ. Мы рассмотрим самый популярный, который несложно сделать самому. В первую очередь нужно доработать каналы — увеличить их диаметр и обточить. Для этого вам понадобится: наждачная бумага

  • ;
  • дрель;
  • Набор фрез;
  • плоская отвертка
  • ;
  • набор ключей.

Сначала разбираем ГБЦ. Для этого разъединяем коллекторы, отсоединяем ресивер от впускного элемента и разбираем его на части.После этого начинаем долгий процесс шлифовки каналов. Самый простой способ – вставить небольшой кусочек трубки в патрон дрели, приклеить к трубке кусочек наждачной бумаги и зашлифовать. В процессе работы бумагу необходимо заменить на мелкозернистый продукт. Тюнинг верха двигателя Lada Granta также требует совмещения ГБЦ и коллектора. Для этого необходимо смазать торцевую часть коллектора толстым слоем солидола и присоединить к нему головку блока цилиндров.

После этого снимите элемент и осмотрите отпечаток. В идеале место перекрытия каналов должно быть без «ступенек», и они естественно будут отображаться на отпечатке. Затем ставим метки в местах нахлеста и продолжаем шлифовку, пока не получим максимальное совпадение. После этого на отшлифованную поверхность наносим новую прокладку. Вы увидите, что края каналов также служат своего рода «ступеньками», то есть интерференцией. Их нужно отшлифовать, чтобы они идеально вошли в отверстия в ГБЦ.После этого снимите прокладку и подсоедините головку блока цилиндров к коллектору.

2

После того, как мы увеличили количество воздуха, поступающего в цилиндры, пришло время позаботиться о качестве последних. Многие водители задумываются об установке защиты только после установки нулевого фильтра. Однако с помощью защиты можно тюнинговать автомобили и с заводскими фильтрами. Защита фильтра не только предотвращает попадание пыли в двигатель автомобиля. Продукт также защищает фильтр от перегрева.Для изготовления «экрана» вам понадобится:

  • небольшой кусочек жести;
  • отвертка или дрель;
  • болты и гайки;
  • ножницы по металлу.

Фильтры на Лада

Для начала необходимо вырезать шаблон будущего «экрана». Для этого прикладываем к фильтру кусок жести и разрезаем лист так, чтобы с одной стороны он защищал фильтр от грязи, а с другой — от тепла мотора. Затем нужно вырезать крепление для защиты, подойдет 3 полоски соответствующей длины.После этого приступаем к сборке. Просверливаем 6 отверстий в «экране». Сверху ставим крепления, фиксируя их гайками или болтами. Загибаем концы крепежных планок так, чтобы они подлезли под хомут фильтра.

Фильтр, настроенный таким образом, требует меньше обслуживания. Кроме того, значительно увеличится срок службы детали, ведь она не будет перегреваться под воздействием мотора.

3

Тюнинг Лада Гранта седан часто подразумевает изменения салона автомобиля.Для этого можно пойти несколькими путями. Первый способ — вложить много денег и времени и полностью переделать кабину. Второй способ – установить в панель несколько вспомогательных устройств и улучшить ее освещение. Третий способ – сделать это, вложив в него минимум средств. Как правило, при таком способе дорабатываются те детали, которые больше всего «бросаются в глаза» водителю и его пассажирам. Одним из таких элементов является верхняя часть панели приборов, то есть ее козырек.

Тюнинг салона

Среди любителей тюнинга ВАЗ принято считать, что перетяжка ветровика дело не из легких.Элемент имеет довольно сложную форму, из-за чего изготовить для него «маску» без швов практически невозможно. Давайте выясним, так ли это на самом деле. В начале работы нужно демонтировать козырек панели приборов, открутив для этого 3 верхних и 3 нижних болта. Затем прикрепите отделочный материал к козырьку и снимите выкройку. Для этого изделие необходимо максимально ровно установить на козырек, учесть все линии изгиба и отметить места, где будет разрезаться материя.В процессе снятия мерок ни в коем случае нельзя забывать о пуговицах по бокам козырька. В этих местах в материале нужно сделать аккуратные отверстия.

Далее вырезаем материал по меркам и начинаем приклеивать на козырек. Очень важно аккуратно использовать клей. Следите за тем, чтобы он не капал на материал и не вытекал из-под него. Как только вы закончите с оклейкой, нужно оставить козырек на сутки, чтобы материал схватился за деталь. После этого устанавливаем элемент на место в салоне. При желании можно обратить внимание на подсветку панели приборов. Со временем она становится тусклее, поэтому потребуется замена штатных лампочек подсветки. Для этого лучше всего подходят белые, синие или красные светодиоды. Для работы нужно 6 лампочек, резистор, 1 м. Проводка и суперклей.

Перед заменой ламп осторожно снимите все стрелки и шкалы. После этого отсоединяем клемму питания подсветки от автомобильного аккумулятора и выкручиваем заводские лампочки.Снимаем штатный световод и зачищаем место за ним, подготавливаем новое освещение. Припаиваем к диодам по ходу проводки. Свободные концы проводки скручиваем в один пучок и подключаем к резистору. После этого подключаем подсветку к клемме аккумулятора и проверяем работу. Если одна из ламп не горит или моргает, то ее провод необходимо зачистить и подключить заново. Если это не поможет, то скорее всего неисправна лампочка.

При исправной работе изготовленной подсветки ее провода необходимо просунуть внутрь приборной панели. Подключаем к батарее и закрепляем лампочки суперклеем. Ждем около 2 часов, после чего надеваем светорассеиватель из куска пенопласта. Поверх него устанавливаем заводские весы и автострелки. Обязательно проверьте исправность стрелок. После установки они не должны быть ниже или выше отметки «0». Заменив штатные лампочки подсветки, вы надолго избавитесь от необходимости регулярно менять светильники. Срок службы диодов в несколько раз больше, чем у заводских ламп.Кроме того, они намного ярче.

Лада «Гранта» лифтбек — автомобиль новый, выпускается в широкой гамме технического оснащения. Усовершенствованная трансмиссия, доработанная подвеска, модельный ряд стандартных двигателей и коробок передач по-прежнему удовлетворяют пользователя. Поэтому тюнинг Лада Гранта Лифтбек в основном касается экстерьера автомобиля.

Тем не менее, приверженцы технического совершенствования автомобилей имеют какое-то отношение к Lade «Granta» лифтбек .

Первоначальная настройка двигателя

Купив новенький автомобиль, вряд ли стоит сразу браться за переделку двигателя. Пусть ваша Гранта обкатывается, адаптируется к нагрузкам, работает в трущихся парах. Возможно, после обкатки динамические характеристики автомобиля покажутся вам идеальными! А может, проявятся заводские дефекты, на которые распространяется гарантия… Однако что-то делать в любом случае нужно.

Воздушный фильтр с нулевым сопротивлением облегчает «дышание» автомобиля.Прирост кислорода в камерах сгорания с таким фильтром составляет 3-6% — в зависимости от оборотов двигателя. Выходная мощность также растет пропорционально.

Еще несколько процентов мощности вашей «Гранты» дает тюнинг-кит выхлопного тракта. Выпускной коллектор с патрубками увеличенного сечения формулы 4-2-1 облегчает вентиляцию цилиндров, снижает сопротивление движению выхлопных газов.

Пара изящных сверкающих глушителей с обожженными пламенем двигателя выхлопными трубами завершают работу. С ними ваша машина станет красивее и быстрее!

Обратить внимание Чип-тюнинг Лада Гранта Лифтбек! Перепрошивка бортового компьютера позволяет оптимизировать взаимодействие водителя и автомобиля. После прошивки автомобиль будет максимально соответствовать вашим ожиданиям и вашему стилю вождения. При этом немного снизится расход топлива, а мощность заметно возрастет.

Электронная педаль газа штука полезная, но не на все модели Лада ставится заводом.Собранная перед чип-тюнинг на лифтбек Лада «Гранта», электронная педаль дает блоку управления возможность точно реагировать на команды водителя. С помощью электронной педали водитель может с высокой точностью измерять усилие, развиваемое двигателем. Что опять же благотворно сказывается на расходе топлива!

Усовершенствованные модели электронных педалей включают в себя блок управления переключателем режимов. Оснастив «Гранту» таким устройством (см. статью на странице), вы сможете изменять режим работы комплекса управления автомобилем в соответствии со своими потребностями.

Глубокий тюнинг двигателя Лада «Гранта» лифтбек может включать установку кованой поршневой группы, расточку цилиндров, «подпитку» двигателя турбиной и азотным ускорителем. Такие процедуры лучше проводить комплексно, так как турбонаддув серийного мотора резко увеличивает риск разрушения поршней при экстремальных нагрузках. Установка дорогих кованых деталей поршневой группы без увеличения производительности системы подачи топлива также не имеет большого смысла.

Стоит отметить, что увеличение мощности мотора влечет за собой необходимость усиления тормозной системы, переделки трансмиссии и подвески. В противном случае наслаждайтесь ловкостью чемпиона. Лада «Гранта» лифтбек это не заставит себя ждать…

Внешний тюнинг Лада «Гранта» лифтбек

Внешний тюнинг Лада «Гранта» лифтбек можно начать с крыльев, заменив стандартные металлические детали кузова на более выразительные из прочного АБС пластика.

Установив полимерные крылья, вы не только улучшите внешний вид автомобиля, но и избавите себя от забот по борьбе с коррозией. Пластик, как известно, не ржавеет и хорошо переносит ударные нагрузки низкой интенсивности. Рубленая линия воздухозаборника тюнингованного крыла добавит спортивной стремительности и здоровой агрессивности.

Пока будущие владельцы обновленной Lada Granta внимательно изучают экстерьер автомобиля, рассуждая об особенностях серийных комплектаций, любители автомобильной уникальности не сидят сложа руки.»Лица не расхожее выражение» — это то, что нужно каждой машине, в том числе хорошенькой с рождения Lada «Granta» лифтбэк !

Различные варианты литья переднего бампера и решетки радиатора, выполненные в ателье мастерами тюнинг Lada Granta Liftback , уже сегодня превосходят лаконичный заводской дизайн!

Особой популярностью у приверженцев динамичного стиля вождения пользуется передний бампер «Я робот». Получив новый обвес, передняя часть автомобиля становится выразительной (и даже немного кричащей), выразительной и аэродинамичной.

Благодаря большому воздухозаборнику, расположенному в центре бампера, двигатель и тормоза передних колес получают дополнительное охлаждение, столь необходимое при активной езде.

Модификации переднего обвеса, выполненные профессионалами автодизайна и придающие автомобилю среднего класса сдержанную солидность, выглядят еще более достойно. «Прищуренные глаза» создают впечатление философской утонченности и непоколебимого спокойствия.А ведь именно этих качеств так не хватает участникам дорожного движения в любом уголке нашей страны!

В белом варианте кузова автомобиль с такой же формой решетки радиатора приобретает несколько сонный вид, однако крупные элементы конструкции улучшают восприятие дизайна. Безоблачный «взгляд» придает автомобилю вид заинтересованности и открытости. Позитивный настрой — в каждой черте белого Granta Liftback!

Полезные мелочи формируют образ

Общий вид Лада «Гранта» лифтбек проработан конструкторами достаточно тщательно. Силуэт модели выгодно отличается от предшествующего ей седана. Вот почему тюнинг Лада Гранта Лифтбек своими руками часто затрагивает мелкие, но важные элементы экстерьера автомобиля.

Маленький спойлер-губа стоит на задней кромке крышки багажника «как родной». Немного увеличив размеры кузова, тюнинговая часть значительно улучшает аэродинамику задней части автомобиля и действительно помогает поддерживать чистоту.заднее стекло. Отметим, что это дополнение безупречно сочетается как с остальным кузовом, так и с дизайном модели в целом.

Визуально приятное и несомненно практичное дополнение тюнинга Лада Гранта и Лифтбек — стильные рейлинги специально разработанные для нового кузова. Для установки рейлингов Grant не нужно сверлить крышу! Детали тюнинга предлагаются в двух цветах: серебристом и черном, и предназначены для установки в штатные точки крепления багажника.

Купив и самостоятельно установив прочные аэродинамические поперечины, вы легко сможете перевозить на крыше любой длинномерный груз массой до 50 кг.

Мы играем по-крупному! Мы громко поем!

Меломан, покупая машину, получает передвижной концертный зал. Точнее, концертный зал делает Лада «Гранта» Лифтбек тюнинг — но мастерам есть где развернуться! Машина просторная, места для оборудования достаточно.Превратить задние двери в динамики и затратно, и сложно, но при ответственном отношении результат впечатляет.

Расширить колею серийного автомобиля непросто: это требует серьезной работы над подвеской и приводом. Накладки на колесные арки превращают обычный автомобиль в гоночный. «Размноженные» и видоизмененные патрубки выхлопных труб выглядят как сопла космического корабля. Стильный бампер объединяет все элементы дизайна и техники автомобиля.Вот что значит сложный тюнинг: машина и звучит, и мчится не хуже ракеты!

И хотя черно-красные языки нарисованного пламени больше напоминают камуфляжный рисунок, абрис передней части машины стал сжатым кулаком, стремительно вонзающимся в пространство.

Спортивные сиденья, эргономичный руль, многоточечные ремни безопасности — отличная находка! Однако молочно-белые изогнутые поверхности передней части салона отвлекают (если не раздражают) излишеством.

Но не будем слишком строги к самодеятельным мастерам тюнинг: Лада Гранта Лифтбек — машина новая, примеров удачных переделок по всем параметрам еще немного. Но стоит прислушаться к опыту решительных грантополучателей!

Все как один говорят о необходимости модернизации шумоизоляции серийного автомобиля. Объемный кузов резонирует на неровностях дороги. Такие ощущения, описывают испытатели, как будто сидишь внутри железного барабана.

Забота о важном

В заводской комплектации всех Грант есть стальная защита двигателя. Это лучше, чем ничего — но как только вы получите лучший щит, не упустите шанс! Приличный дорожный просвет (20 см для модели с механической коробкой передач, 16 см для автомобилей с автоматической коробкой передач) — не гарантия от наезда на камни и другие препятствия на дороге. По отзывам, тюнинговая защита двигателя и коробки передач у «Калины» идеальна.

Подкрылки (или подкрылки, по-русски) — важная часть скоростного автомобиля. Полимерный материал поглощает все удары камешков, брызги грязи – и в результате защищает детали кузова от истирания и коррозии.

Есть опасения, что подкрылки настолько нарушают вентиляцию кузовного пространства, что ржавление металла ускоряется в разы. Такие опасения необоснованны. Качественные рундуки, установленные без самостоятельного сверления кузова, полезны — и немало.

Согласитесь, колеса стандартного комплекта 175/70 R13 местами выглядят утонченно, а довольно элегантный кузов утяжеляет.

Много смысла — особенно в плане облегчения перекатывания по неровностям дороги — есть в установке пятнадцатидюймовых колес,

Или даже шестнадцати-семнадцатидюймовые диски с низкопрофильной резиной. Правда, решение подобного рода оправдано только при наличии везде хороших дорог с качественным покрытием.

Наружные зеркала заднего вида с электрорегулировкой, обогревом и двусторонними повторителями поворотов – веление времени. Световой сигнализации много не бывает! Установить такие зеркала своими руками несложно. Выключатель обогревателя синхронизирован с обогревателем заднего стекла.

При покупке убедитесь, что задние светодиоды не слепят водителя — иначе, включив поворотник налево, вы будете вынуждены заслоняться от слишком яркого света цветными светодиодами.

Подумаем о прекрасном

Ваша Лада «Гранта» Лифтбэк черная как ночь, а кузов блестит как смоляное зеркало? Поместите фары с черным фоном между отражателями для более серьезного вида.

Когда-то в Германии считалось шиком обтянуть крышу автомобиля (неважно какого) черной кожей, имитируя таким образом кабриолет. В новом веке — новые гаджеты! Согласитесь, что черная глянцевая пленка на крыше белой «Гранты» — это круто!

Добавляет прохлады той же черной пленке на стекле.

Черная пленка не всегда уместна. Как бы эффектно это не становилось Лада Гранта Лифтбек, заклеивать фары в черный это бред! Однажды света будет недостаточно, чтобы заметить препятствие и вовремя среагировать на него. Результат — авария!

Некоторые люди также находят красивым уменьшение зазора до предельных миллиметров. Согласитесь с таким тюнингом Lada «Granta» Liftback сложно.

Пришла на авторынок совсем недавно. Нельзя сказать, что это идеальная модель автомобиля. позволяет минимизировать его мелкие недостатки и подогнать параметры автомобиля под нужды конкретного автолюбителя. Отличный вариант улучшения внешнего вида можно посмотреть на видео.

Работы по улучшению двигателя и акселератора

Первое на что нужно обратить внимание это чип тюнинг двигателя. Штатная настройка электронной микросхемы рассчитана на оптимальные параметры для обкатки двигателя.В последующем микросхема извлекается из блока и перенастраивается. Сделать это самостоятельно можно только при наличии некоторого опыта и знаний основ электроники. Среднестатистический водитель с этой работой не справится, поэтому чип-тюнинг двигателя проводят в специализированных автомастерских. Простая «перепайка» микросхемы позволяет увеличить мощность двигателя на четверть. При этом внутренний износ деталей снизится почти вдвое.

Второй момент, который водители не проигнорируют, касается педали акселератора.Поначалу машина плохо реагирует на нажатие педали: для достижения высоких оборотов педаль нужно просто вдавить в полку. Этого можно избежать, внеся определенные изменения в систему впуска, подтянув трос дроссельной заслонки и отрегулировав распредвал.

Тюнинг шасси

Постоянно тюнингуется. Дело в том, что подвеска Гранты получилась мягкой, рассчитанной, скорее, на комфортную езду по ровным дорогам. Увы, таких дорог в реальности нет, поэтому необходимы доработки задней подвески Гранты своими руками.

Можно просто: отрезать один виток пружины. Автомобиль потеряет комфорт, но дополнительная жесткость придаст устойчивости на дороге. Переднюю подвеску можно увидеть на амортизаторах от Lada Kalina. Они немного ниже, поэтому автомобиль получит более низкую стойку.

Внешний тюнинг автомобиля

Внешний тюнинг Lada Granta не требуется, так как автомобиль выглядит прилично. Но именно в этом направлении автовладельцы работают особенно усердно. Lada Granta переделывается до неузнаваемости своими руками.Автовладельцы особенно предвзято относятся к бамперу. Считается, что он выглядит немного староватым и неагрессивным. используется чаще других.

Идеально подходит по застежкам, выглядит современно. Но перспективнее видится использование бампера СТМ. Вы значительно выиграете в комфорте. Форма воздухозаборника такова, что создается дополнительное охлаждение как двигателя, так и тормозной системы. Разъемы фар и противотуманных фар тоже выглядят хорошо.

Задний бампер заменяется редко.

Чаще всего тюнинг в задней части автомобиля ограничивается установкой спойлера. Для многих автолюбителей это простое украшение. На самом деле спойлер имеет большое значение при движении на высоких скоростях. Он «работает» как крыло самолета с той лишь разницей, что здесь поток воздуха давит на спойлер, прижимая автомобиль к дорожному полотну. Только правильный расчет аэродинамики спойлера придаст устойчивости автомобилю, поэтому делать его самостоятельно не рекомендуется.Посмотрите видео, демонстрирующее действие спойлера в дороге, и вы сами откажетесь от идеи сделать его в домашних условиях. Как правило, эти детали изготавливаются на заказ в мастерских. Там же красится готовое изделие. Хозяину остается только установить его своими руками.

Иногда меняют сетку радиатора и переднюю панель.

Сетка радиатора также не очень хорошо защищает двигатель. Летом это чревато засорением двигателя (да и салона тоже) пухом от растений и насекомых.Самостоятельно устранить этот недостаток проще простого: между ребрами решетки радиатора устанавливается алюминиевая сетка (см. видео). Закрепить можно качественным клеем, но лучше делать это струбцинами. Будет обеспечена защита от грязи и насекомых.

Изменение внешнего вида салона зависит только от фантазии и изобретательности дизайнера

Тюнинг передней панели автомобиля и салона в целом можно отнести к разряду дизайнерских изысканий автовладельцев.Гранта доступна в различных вариантах оформления салона и передней панели, поэтому лучше приобрести тот автомобиль, который максимально соответствует вашим запросам. Как показывают фотографии отделки салона, владельцы автомобилей не всегда довольны дизайном салона. Описывать варианты дизайнерских решений нет смысла, так как они могут не понравиться владельцу автомобиля. Применяются неожиданные решения, начиная от замены заводской обивки и заканчивая полной заменой сидений.

Для Гранты, тюнинг своими руками, фото которого вы видите, стоит не очень дорого и не занимает много времени.

Базовая комплектация автомобиля такова, что к нему подходят многие детали от других автомобилей, придавая стильные внешние изменения. Та же Lada Kalina, о которой говорилось ранее, является практически идеальным «донором» запчастей для Lada Grant. Рынок комплектующих насыщен до предела, поэтому тюнинг Лады Гранты не должен создавать проблем автовладельцам. Дерзайте, возможно, ваш вариант тюнинга автомобиля станет прототипом новой Лады.

Такой ход поможет решить проблему на всех термостатах, за исключением продукции Luzar.

Доработка фонаря заднего хода


Штатные лампы заднего хода не удовлетворяют потребности многих владельцев Лада Гранта. Особенно их плохо видно в плохих погодных условиях, например, в сильную метель или в тумане. Поэтому здесь также необходимо искать решение. Лучший выход из ситуации – установка ксеноновой лампы. Световые приборы такого рода не являются новинкой для иномарок даже в «стандартной» комплектации, но АвтоВАЗ к этому еще не пришел.Поэтому дорабатывать машину придется самостоятельно. Разберем установку и подключение ксеноновых ламп h2 на 5000 К с блоком розжига. Установка выполняется следующим образом:

  1. Демонтируем старый светильник.
  2. Установка новой лампы.
  3. Штатные провода подключаем к блоку розжига, от которого питается ксеноновая лампа.

Вот, собственно, и все. Небольшие затраты времени и элементарное знание электрической схемы Lada Granta помогут вам добиться яркого холодного света, который будет заметен при любом освещении.Теперь можно спокойно делать резервные копии как ночью, так и в туман или бурю.

При выборе автомобиля для тщательного тюнинга многие обращают внимание на автомобили российского производителя. В первую очередь это связано с тем, что автомобили АвтоВАЗа имеют невысокую стоимость. При тюнинге таких транспортных средств можно добиться значительного улучшения ходовых качеств. автомобиль и его внешний вид.

Ведь тюнинг автомобиля можно сравнить с другим творчеством, а мастеру нужен «чистый холст» для создания нового шедевра.Тюнинг Lada Granta может быть как тщательным: установка всех новых агрегатов и полное изменение внешнего вида, так и частичным: доработка установленного двигателя, подвески и других узлов.

Если произвести тюнинг Лады Гранты основательно, то сразу определить, что это тюнинг Лада Гранта своими руками, в некоторых случаях это будет практически невозможно — настолько сильные изменения.

Лада Гранта тюнинг двигателя

При тюнинге двигателя меняются все показатели: мощность, крутящий момент и расход топлива.Основные показатели, на которые многие обращают внимание, это мощность и крутящий момент. Также есть возможность изменить вид используемого топлива, то есть установить газовую турбину.

Не рекомендуется проводить тюнинг двигателя в условиях, если автомобиль был куплен в салоне. Это связано с тем, что первые десять-двадцать тысяч километров пробега двигателя, в блоке цилиндров происходит процесс, в котором набиваются зеркала на цилиндрах, остальные детали прирабатываются.

Также стоит отметить, что при покупке автомобиля из салона может возникнуть ситуация, при которой до прохождения первых, гарантированных 10 000 километров может появиться серьезная неисправность, которую необходимо устранять в салоне.После несанкционированного вмешательства и модификации двигателя гарантия на него пропадает.

Тюнинг Лада Гранта фото

Тюнинг двигателя Лада Гранта может проводиться как без серьезного вмешательства в конструкцию, так и с работами, которые принесут кардинальные изменения.

Считать работу не предусматривающей кардинальных изменений в конструкции двигателя Лады Гранты .

Тюнинг двигателя, не предусматривающий серьезных конструктивных изменений, включает в себя:

Установка воздушного фильтра нулевого сопротивления

Установка воздушного фильтра нулевого сопротивления — позволяет в значительной степени обогатить топливо кислородом.Ведь чем лучше смесь насыщена кислородом, тем выше мощность, а эффект может быть на уровне 3-5% прироста мощности от базового значения, в зависимости от характеристик двигателя.

Этот вариант позволяет не только лучше обогащать смесь, но и очищать поступающий воздух. Такой фильтр необходимо обслуживать один раз на 2-3 тысячи километров пройденного пути, поэтому при его засорении подача кислорода будет значительно снижена.Такой тюнинг двигателя Лада Гранта лучше проводить вместе с чип-тюнингом.

Чип-тюнинг двигателя Лада Гранта

Чип-тюнинг – один из недорогих способов увеличения мощности и одновременного снижения расхода топлива. Вся работа по выполнению такого тюнинга заключается в установке новой прошивки в блоке управления. Благодаря новой прошивке двигатель будет вести себя иначе.

Для разных автомобилей должны использоваться разные программы. Для спортивных автомобилей эти изменения вносятся вручную путем тонкой настройки после многочисленных испытаний.Этот метод чип-тюнинга двигателя стоит дорого, а оборудование для его реализации установлено далеко не в каждом автосервисе, что усложняет эту задачу.

Тюнинг выхлопной системы

Тюнинг выхлопной системы также может увеличить мощность двигателя. Для этого устанавливают прямоточный вариант глушителя, избавляются от катализатора и заменяют штатную выхлопную систему специальной полностью прямоточной выхлопной системой.

Ведь основным принципом работы выхлопной системы является следующая закономерность: чем меньше препятствий на пути газов, тем больше мощность.При создании новой выхлопной системы автомобиль получает насыщенный спортивный звук.

Тюнинг салона Лада Гранта

Тюнинг салона Лады Гранты можно осуществить без особых затрат при выборе обычных схем. Стоимость работ зависит от типа используемых материалов, а также степени изменения интерьера. Но в любом случае тюнинг салона Гранты обойдется дешевле, чем девятка, ведь девятка очень старая и много чего в ней нужно менять.

Тюнинг салона Lada Granta, на фото которого видно, что правильная доработка салона способна удивить многих автомобилистов, и осуществляется как по собственному дизайну, так и по уже созданным проектам.

Для достижения наилучшего результата к таким работам по смене автомобиля нужно подходить комплексно. Также необходимо изменить и улучшить подвеску, шасси и все мелкие элементы, так как именно в этом случае можно создать практически идеальный автомобиль с новыми возможностями и уникальным дизайном.

А вот и видео про Ладу Гранту Спорт:

Аксессуары Lada Granta DIY. Тюнинг лады гранта, тюнинг своими руками фото

Такой ход поможет решить проблему на всех термостатах, за исключением продукции Luzar.

Фонарь заднего хода доработка


Штатные фонари заднего хода не удовлетворяют потребности многих владельцев Лада Гранта. Особенно их плохо видно в плохих погодных условиях, например, в сильную метель или в тумане. Поэтому и здесь нужно искать решение. Лучший выход из ситуации – установка ксеноновой лампы. Световые приборы такого рода не являются новинкой для иномарок даже в «стандартной» комплектации, но АвтоВАЗ к этому еще не пришел. Поэтому дорабатывать машину придется самостоятельно.Разберем установку и подключение для ксенона х2 5000 К с блоком розжига. Установка выполняется следующим образом:

  1. Демонтируем старый светильник.
  2. Установка новой лампы.
  3. Штатные провода подключаем к блоку розжига, от которого питается ксеноновая лампа.

Вот, собственно, и все. Небольшие затраты времени и элементарное знание электрической схемы Lada Granta помогут вам добиться яркого холодного света, который будет заметен при любом освещении.Теперь вы можете спокойно делать резервные копии как ночью, так и в туман или бурю.

Пришла на авторынок совсем недавно. Нельзя сказать, что это идеальная модель автомобиля. позволяет минимизировать его мелкие недостатки и подогнать параметры автомобиля под нужды конкретного автолюбителя. Отличный вариант улучшения внешнего вида можно увидеть на видео.

Работы по улучшению двигателя и акселератора

Первое на что стоит обратить внимание это чип тюнинг двигателя. Штатная настройка электронной микросхемы рассчитана на оптимальные параметры для обкатки двигателя.В последующем микросхема извлекается из блока и перенастраивается. Сделать это самостоятельно можно только при наличии некоторого опыта и знаний основ электроники. Среднестатистический водитель с этой работой не справится, поэтому чип-тюнинг двигателя производят в специализированных автомастерских. Простая «переделка» микросхемы позволяет увеличить мощность двигателя на четверть. При этом внутренний износ деталей снизится почти вдвое.

Второй момент, который водители не оставят без внимания, касается педали акселератора.Поначалу машина плохо реагирует на нажатие педали: чтобы добиться высоких оборотов, педаль нужно просто вдавить в полку. Этого можно избежать, внеся определенные изменения в систему впуска, подтянув трос дроссельной заслонки и отрегулировав распределительный вал.

Тюнинг шасси

Постоянно тюнингуется. Дело в том, что подвеска Гранты получилась мягкой, рассчитанной, скорее, на комфортную езду по ровным дорогам. Увы, таких дорог в реальности нет, поэтому необходимы доработки задней подвески Гранты своими руками.

Можно просто: отрезать один виток пружины. Автомобиль потеряет в комфорте, но дополнительная жесткость придаст устойчивости на дороге. Переднюю подвеску можно увидеть на амортизаторах от Lada Kalina. Они немного ниже, поэтому автомобиль получит более низкую стойку.

Внешний тюнинг автомобиля

Внешний тюнинг Lada Granta производить не обязательно, так как автомобиль выглядит прилично. Но именно в этом направлении автовладельцы работают особенно усердно. Lada Granta переделывается до неузнаваемости своими руками.Особенно предвзято автовладельцы относятся к бамперу. Считается, что он выглядит немного старым и неагрессивным. используется чаще других.

Идеально подходит по застежкам, выглядит современно. Но перспективнее видится использование бампера СТМ. Вы значительно выиграете в комфорте. Форма воздухозаборника такова, что создается дополнительное охлаждение как двигателя, так и тормозной системы. Разъемы фар и противотуманных фар тоже выглядят хорошо.

Задний бампер заменяется редко.

Чаще тюнинг в задней части автомобиля ограничивается установкой спойлера. Для многих автолюбителей это простое украшение. На самом деле спойлер имеет большое значение при движении на высоких скоростях. Он «работает» как крыло самолета с той лишь разницей, что здесь поток воздуха прижимает спойлер вниз, прижимая автомобиль к дорожному полотну. Только правильный расчет аэродинамики спойлера придаст устойчивости автомобилю, поэтому делать его самостоятельно не рекомендуется.Посмотрите видео, демонстрирующее действие спойлера в дороге, и вы сами откажетесь от идеи делать его дома. Как правило, эти детали изготавливаются на заказ в мастерских. Там же красится готовое изделие. Хозяину остается только установить его своими руками.

Иногда меняют сетку радиатора и переднюю панель.

Сетка радиатора также не очень хорошо защищает двигатель. Летом это чревато засорением двигателя (да и салона тоже) пухом от растений и насекомых.Устранить этот недостаток самостоятельно проще простого: между ребрами решетки радиатора устанавливается алюминиевая сетка (см. видео). Закрепить можно качественным клеем, но лучше делать это струбцинами. Будет обеспечена защита от грязи и насекомых.

Изменение внешнего вида салона зависит только от фантазии и изобретательности дизайнера

Тюнинг передней панели автомобиля и салона в целом можно отнести к разряду дизайнерских изысканий автовладельцев.Гранта доступна в различных вариантах оформления салона и передней панели, поэтому лучше приобрести тот автомобиль, который максимально соответствует вашим запросам. Как видно на фотографиях внутренней отделки салона, владельцы автомобилей не всегда довольны дизайном салона. Описывать варианты дизайнерских решений нет смысла, так как они могут не понравиться владельцу автомобиля. Применяются неожиданные решения, от замены заводской обивки до полной замены сидений.

Для Гранты, тюнинг своими руками, фото которого вы видите, стоит не очень дорого и не занимает много времени.

Базовая комплектация автомобиля такова, что к нему подходят многие детали от других автомобилей, придавая стильные внешние изменения. Та же Lada Kalina, о которой говорилось ранее, является практически идеальным «донором» запчастей для Lada Grant. Рынок комплектующих насыщен до предела, поэтому тюнинг Лады Гранты не должен создавать проблем автовладельцам. Дерзайте, возможно, ваш вариант тюнинга автомобиля станет прототипом новой Лады.

Lada Granta – одна из последних новинок на рынке отечественного автопрома.Несмотря на свою «молодость» автомобиль уже пользуется большой популярностью и спросом у автомобилистов, предлагая им отличное сочетание качества, комфорта, надежности и доступности. Несмотря на это, многие владельцы этого автомобиля мечтают о тюнинге и технической доработке. Именно поэтому сегодня мы поговорим о том, каким должен быть тюнинг Гранты своими руками и что в него входит.

Внешний тюнинг

Стоит отметить, что по сравнению с предшественниками новый ваз лифтбек выглядит вполне презентабельно и очень часто владельцы предпочитают оставить внешний вид без существенных изменений, сосредоточив свое внимание на других аспектах тюнинга.Те, кого не устраивает все стандартное, вносят ряд изменений в экстерьер своими руками, в том числе:

  • Установка переднего бампера с улучшенным воздухозаборником — такой тюнинг обновляет дизайн вазовского лифтбека, при этом способствуя лучшему обдуву передних тормозов и силовой установки. Идеальное решение для тех, кто любит спорт и высокие скорости;
  • Установка новых пластиковых крыльев и других элементов кузова – помимо чисто декоративной выгоды владелец получает и материальную выгоду, ведь такой обвес не подвержен коррозии и способен служить несравненно дольше;
  • Установка компактного заднего спойлера — он находится на крышке грузового отсека, не только защищая стекло от грязи, но и улучшая аэродинамику задней части автомобиля;
  • Тюнинг оптики — стандартные фары многих владельцев не устраивают, поэтому они стремятся заменить их на улучшенные модели.Как вариант, можно использовать готовый комплект светотехники или подобрать фары самостоятельно;
  • Установка рейлингов на крышу — их использование актуально для любителей путешествовать, а установка настолько проста, что с ней без проблем справится даже самый неопытный водитель.

Внутренние изменения

Продолжая тюнинг Lada Granta, стоит обратить внимание на внутреннюю отделку салона. Здесь также есть ряд аспектов, которые можно менять вручную, а именно:

Технический тюнинг

Не совсем целесообразно проводить значительный тюнинг двигателя ВАЗ, требующий серьезного вмешательства в его конструкцию, особенно на новой модели.И в этом случае о гарантии, скорее всего, придется забыть. Именно поэтому сегодня мы разберем те варианты апгрейда, которые не требуют кардинальных изменений:

Заключение

Тюнинг автомобиля – достаточно трудоемкий, длительный и финансово затратный процесс. Если вы все же решили обновить свою Lada Granta, помните, что для получения максимально качественного и сбалансированного результата модернизацию автомобиля следует проводить комплексно, равномерно распределяя усилия по всем наиболее значимым узлам и агрегатам.Только так вы сможете придать ему не только уникальный дизайн, но и улучшенные технические параметры.

Никто не смеет утверждать, что практичная модель Lada Granta седан за короткий период своего существования приобрела завидную популярность среди многочисленной армии отечественных автомобилистов. Нельзя утверждать, что машина достигла пика совершенства, хотя собственноручно устранить присутствующие в ней мелкие недостатки вполне возможно. Для этого вам потребуется сделать популярный сегодня тюнинг своими руками, который позволяет не только придать Гранте индивидуальный шарм, но и подстроиться под нужды конкретного владельца.

Как улучшить мотор и ускоритель в сборе?

Здесь на первый план должен выйти чип-тюнинг. Базовая настройка предполагает реализацию электронным блоком управления усредненных и оптимальных параметров работы двигателя, лояльных к процессу обкатки автомобиля. Процедура модернизации предполагает удаление микросхемы из ЭБУ и ее перенастройку. Выполнять эту деятельность самостоятельно следует только при наличии определенных знаний и опыта в области программирования.Среднестатистическому владельцу седана Лада Гранта недоступна такая специфическая процедура, как чип-тюнинг, поэтому ее выполнение следует доверить опытным программистам из специализированных ателье. Если правильно выполнить прошивку, то вполне можно добиться прибавки мощности в пределах 15-20%. Здесь же можно отрегулировать уровень расхода топлива. Этот параметр зависит от версии программного обеспечения.

Еще один значимый момент, который может спровоцировать повышенное внимание владельца, это педаль акселератора.Стандартная настройка агрегата характеризуется «вялой» реакцией мотора седана Lada Granta на нажатие соответствующей педали. Для достижения резкого повышения оборотов требуется более глубокое утопление педали, но и здесь неизбежны задержки. Эту досадную особенность можно свести к минимуму, подтянув трос привода демпфера и отрегулировав распредвал.

Секреты тюнинга подвески

Ходовая часть седана Лада Гранта легко поддается такому делу как тюнинг своими руками.Конструкция подвески изначально была разработана с упором на плавность хода и комфорт. Этот аспект приложит все усилия на дорожных покрытиях хорошего качества. Но в действительности дело обстоит иначе, в связи с чем подвеска седана Лада Гранта требует трансформации.

Действия не замысловатые, а заключаются в разрезании по одному витку на каждой из пружин. Полученная жесткость способна обеспечить автомобилю недостающую ранее устойчивость. Также можно заменить передние амортизаторы на те, что от Калины.За счет меньшей длины заимствованных стоек они обеспечат более низкой посадке улучшенный седан LADA Granta.

Тюнинг элементов экстерьера

Модернизировать внешний вид седана LADA Granta можно по желанию, так как производитель наделил свое детище довольно эффектным экстерьером, о чем свидетельствует фото. Парадокс в том, что тюнинг кузова своими руками – самое популярное направление среди предрасположенных к этому искусству владельцев. Некоторые любители добиваются полной неузнаваемости внешнего вида своего автомобиля, выполняя операции по трансформации.Особенно предвзято относятся к бамперам, так как владельцы считают его экстерьер устаревшим. Конструкция «Робот» используется чаще аналогов благодаря простоте крепления и современному внешнему виду. Самый прогрессивный вариант – вариант бампера STM. Здесь обеспечен комфорт. Конструкция воздухозаборника предполагает создание дополнительного потока, что способствует более эффективному охлаждению моторного и тормозного агрегатов, и на фото выглядит неплохо. Посадочные гнезда для головной оптики имеют оригинальный дизайн.

Кормовой бампер меньше подвержен таким вещам, как тюнинг, по сравнению с его передним «собратом». Большинство владельцев ограничиваются лишь установкой спойлера. Некоторые любители не находят применения в этом «аксессуаре», но это не так. Спойлер наделен важной функцией, как только скорость автомобиля приближается к максимальному значению. Он позволяет концентрировать и направлять встречный воздушный поток в сторону дорожного полотна, создавая известную прижимную силу. Деталь изготавливается специализированными ателье.Приобретая продукт, владелец имеет только «обязательство» установить его.

Штатная решетка перед радиатором не способна похвастаться эффективной защитной способностью. Ситуация особенно усугубляется летом, когда бешеные стаи насекомых с бешеной яростью торпедируют беспомощные соты радиатора. Избежать этой печальной участи очень легко. Достаточно смонтировать сетку между краями решетки. Зафиксировать можно клеем или струбцинами, что эффективнее.

Если коснуться тюнинга салона, то к нему стремятся только самые требовательные владельцы, желающие выделиться из общей массы владельцев Гранты. Изначально производитель предусмотрел для своего детища множество комплектаций, подразумевающих возможность выбора передней панели, оснащения опциями и обивки салонных элементов. Но некоторые субъекты до сих пор бесятся над штатным салоном и склоняются не только к замене «родной» обивки, но и к установке новых сидений.

Благодаря внушительному опыту в сфере такого дела, как тюнинг, которым на просторах сети любезно делятся успешные владельцы (фото и видео), можно выделить варианты трансформации, позволяющие добиться эффектности во внешнем виде интерьер и экстерьер при достаточно «вменяемом» бюджете.

В качестве альтернативы тюнингу может быть использована модернизация деталей седана LADA Granta от других автомобилей. Установка таких изделий имеет достаточно возможностей, чтобы преобразить вашу «ласточку», наделив ее уникальностью.К счастью, на рынке очень много предложений продукции-аналога, что позволяет творческим владельцам проводить тюнинг своими руками. Гранты с невероятной ловкостью добиваются завидных результатов.

По словам представителей АвтоВАЗа, этот автомобиль станет объектом повышенного внимания заводских конструкторов. Усилия будут направлены на то, чтобы дать автолюбителям простор для технического тюнинга и тюнинга салона Lada Granta. Интересный факт: еще до появления первой серийной модели Гранты компания ТМС-Спорт подверглась значительному тюнингу.Затем тюнинг двигателя заключался в установке турбины, увеличении до 210 […]

Интерес Спросить

В описаниях комплектаций Лады Гранты вы наверняка часто встречали слово Атермальное стекло. Начиная с комплектации «Норма», а именно 21900-41-015, такие стекла поставляются с завода на автомобили. Что за стекло, давайте подробнее Что такое атермальное стекло? Обычное стекло пропускает практически весь спектр солнечного излучения, и летом в салоне может быть очень жарко, а зимой, благодаря хорошей теплопроводности, […]

Мы несем красоту

Изменение цвета дефлекторов и ручек изменился весь вид в салоне До После Как сделали Дефлекторы (форсунки вентиляции) снять не долго — это займет не более десяти минут. Чтобы придать кольцам вокруг вентиляционных отверстий яркий цвет, для начала их нужно подготовить к покраске: Чтобы снять глянец (на нем плохо красится), достаточно немного поработать наждачной шкуркой. Для обезжиривания поверхности […]

Делаем удобнее

Lada Granta — новый и невероятно популярный переднеприводный седан от АвтоВАЗа, сочетающий в себе качество и доступность. Но эта модель комплектуется без люка, что не очень удобно в жаркую погоду. Это не большое неудобство можно легко решить, сделав альтернативу установке кондиционера и установке люка, тем самым сделав дополнительную вентиляцию самостоятельно. Это решение позволит авто […]

Мы несем красоту

Лада Гранта сзади выглядит немного пустой.Спойлер исправляет это. Спойлер от «десятки» идеален – не агрессивен и придает машине красивый законченный вид. Как установить спойлер на Лада Гранта По желанию можно приобрести спойлеры нужного цвета. После того, как спойлер окажется у вас на руках, вам останется только его установить. Перед установкой спойлера необходимо […]

Наводим красоту

Чтобы оценить всю красоту, посмотрите видео Как поменять цвет подсветки комбинации приборов Лада Гранта Для начала нужно снять накладку панели приборов, которая держится на трех обычных саморезах.После этого можно снять саму заглушку (4 винта) и отсоединить чип. Качество пластика не очень, так что его легко можно сломать. Будь очень осторожен! Щит состоит из трех частей, […]

Установка дополнительного оборудования

В этот раз речь пойдет о крутом тюнинге. Танцоры будут особенно рады увидеть это в своей машине. Летом не обязательно идти на дискотеку, дискотека будет с вами. Чтобы сразу было понятно, о чем речь, представляем видео: Выглядит потрясающе, правда? Девочки, увидеть это чудо с мигалками точно будет вам.Тюнинг авторский Сначала хотелось бы […]

Очумелые ручки

Стробоскоп (от греч. ??????? — «кружение», «беспорядочное движение» и ?????? — «смотрящий») — прибор, позволяющий быстро воспроизводить повторяющиеся яркие световые импульсы. Изначально это была игрушка. Часто используется на вечеринках, дискотеках и концертах. А еще используем его на автомобиле Лада Гранта для тюнинга. Делаем стробоскоп сами. Изначально было решено, что схема стробоскопа должна занимать как можно меньше места.Используемая нами схема проста и дешева. Для […]

Бережный уход

Решил поставить сеточку в бампер, думаю меньше насекомых будет, а то надоело это кладбище домашних мух… Ну и вид, на мой взгляд, поинтереснее стал… Раздел Тюнинг

Анализ связывания Interbase-FRET для пре-микроРНК

FRET-меченый дизайн олигорибонуклеотидов

Зрелые миР не содержат вторичных структурных элементов, которые обеспечивают специфическое и высокоаффинное связывание малых молекул.Следовательно, стратегии регуляции miR с использованием малых молекул часто основаны на предшествующем или предшествующем биогенезе miR. Pre-miR представляют собой шпильки длиной примерно 70 нуклеотидов, содержащие дискретные вторичные и третичные структуры, чувствительные к специфическому связыванию лекарствоподобными молекулами. Изучение предсказанной вторичной структуры полноразмерной шпильки pre-miR-21 ( 1 , таблица 1, рис. 1a) 40 и доступной структуры ЯМР-решения сегмента шпильки pre-miR-21 34 выявили, что большинство вторичных структур, с которыми потенциально может связываться лиганд (несоответствующие выпуклости и петля-шпилька), расположены вблизи петли-шпильки и функционального сайта процессинга Dicer (рис.1а). С точки зрения химического синтеза длинные модифицированные последовательности РНК сложно подготовить, что привело нас к усечению полноразмерной последовательности pre-miR-21 до шпильки из 39 нуклеотидов. Затем мы добавили две дополнительные пары GC, чтобы смягчить эффекты изнашивания концов, получив укороченный олигорибонуклеотид pre-miR-21 длиной 43 нуклеотида ( 2 , таблица 1). Эта конструкция использовалась в качестве отправной точки для разработки FRET-меченых олигорибонуклеотидов ( 5 и 7 , таблица 1, рис. 1b,c) и соответствующих донорских олигорибонуклеотидов ( 6 и 8 , таблица 1) для нашего анализа interbase-FRET.Из-за этой конструкции олигорибонуклеотидов наш анализ может исследовать структурные изменения в пре-миР с использованием высокочувствительного считывания на основе флуоресценции (рис. 1b, c).

Таблица 1. Последовательности олигорибонуклеотидов, использованные в этом исследовании.

Мы предполагали, что, заменив пару остатков C в олигорибонуклеотиде 2 парой tC O –tC нитро РНК FRET (рис. 1d), мы сможем отслеживать изменения в эффективности FRET, которые возникают от связывания лиганда (рис.1б,в). Кроме того, параллельное использование последовательностей 5 и 7 (которые сообщают о разных областях пре-миР-21) также позволяет нам определить, где происходит связывание лиганда. Основываясь на предыдущей работе, касающейся tC O – tC nitro внутри дуплексов РНК 28 , мы ожидали, что вставка этой пары FRET окажет минимальное влияние на структуру pre-miR-21. Соответствующие 5′-биотинилированные последовательности ( 3 и 4 , таблица 1), обеспечивающие присоединение олигорибонуклеотида к покрытой стрептавидином поверхности, готовили для иммобилизации на покрытом стрептавидином SPR-чипе.Последовательность 3 не содержит донора или акцептора, в то время как последовательность 4 содержит пару tC O -tC нитро FRET (таблица 1), чтобы проверить, влияет ли включение наших меток на показания связывания лиганда при использовании SPR. техника.

Эталонные измерения взаимодействия ITC и SPR

ITC использовали для изучения экспериментальных условий связывания аминогликозида неомицина с немодифицированной укороченной пре-миР-21 ( 2 , таблица 1), включая оптимизацию условий буфера.В конечном счете, мы использовали буфер какодилата натрия (20 мМ какодилата натрия, 80 мМ NaCl, 100 мМ общего Na + , pH 7,2), который ранее использовался в исследованиях связывания аминогликозидов с сайтом инициации димеризации РНК ВИЧ-1 41 . Этот буфер привел к превосходной воспроизводимости изотерм связывания ITC и константе диссоциации ( K d ) 5,2 ± 0,8 мкМ для взаимодействия между pre-miR-21 2 и неомицином (рис. 2a, b).

Рисунок 2

Связывание неомицина с пре-миР-21.( b ) Данные ITC, показывающие выделение тепла при титровании неомицина до олигорибонуклеотида 2 (10 мкМ). ( b ) Интегральные площади пиков из панели ( a ) по сравнению с неомицином: молярное соотношение 2 для последовательных добавлений и построенная кривая (сплошная линия, при условии связывания 1:1), дающая K d 5,2 ± 0,8 мкМ. ( c ) Связывание неомицина с олигорибонуклеотидом 3 при 10 различных концентрациях с использованием SPR, где выделенная зеленым цветом область показывает стационарные условия, из которых определяются значения K d .( d ) Подогнанная кривая (сплошная линия, предполагающая эквивалентную аффинность для всех сайтов связывания) из панели ( c ), дающая среднее значение K d , равное 3,9 ± 2,8 мкМ.

Чтобы выяснить, оказывает ли пара tC O –tC нитро РНК FRET какое-либо влияние на аффинность связывания между аминогликозидами и нашими мечеными FRET олигорибонуклеотидами, было выполнено сравнительное измерение SPR с использованием биотинилированных FRET-пар, содержащих пре- miR-21 ( 4 , таблица 1) и ее аналог без пары FRET ( 3 , таблица 1).Было определено, что значения неомицина K d для последовательностей 3 и 4 составляют 3,9 ± 2,8 мкМ (рис. 2c, d) и 2,7 ± 1,7 мкМ (таблица 2) соответственно. Эти результаты хорошо согласуются с данными ITC (рис. 2а, б). Различие в сродстве неомицина к 3 и 4 было незначительным и находилось в пределах экспериментальной погрешности измерения ППР. Это убедительно свидетельствует о том, что пара FRET не нарушает общую вторичную структуру конструкции pre-miR-21 и взаимодействие лиганд-pre-miR.

Таблица 2 Сродство связывания SPR для олигорибонуклеотидов 3 и 4 , сродство связывания между основаниями FRET для олигорибонуклеотидов 5 и 7 и соответствующие рейтинги всех аминогликозидов.

Константы диссоциации взаимодействия пре-миР-21 с аминогликозидами, определенные с помощью SPR

Чтобы сравнить наш анализ связывания между основаниями-FRET (см. ниже), мы исследовали аффинность связывания ряда из 12 аминогликозидов (таблицы 2 и S2; см. Рисунок S2 для структур) до miR-21 3 и 4 с использованием SPR.Полученные константы диссоциации варьировались от приблизительно 3 мкМ до 300 мкМ как для pre-miR-21 3 , так и для 4 , и эти значения использовались для определения ранга связывания SPR (таблица 2). Из-за схожей аффинности связывания для пре-миР-21 3 и 4 мы пришли к выводу, что введение нашей пары FRET существенно не изменило способ или силу связывания или общее взаимодействие между пре-миР и этим типом лиганда. Наши результаты согласуются с предыдущим исследованием Yan et al.в котором анализ поляризации флуоресценции использовали для идентификации неомицина, нетилмицина, сизомицина и тобрамицина как особенно сильнодействующих связывающих веществ с пре-миР-21 19 . Примечательно, что аминогликозиды демонстрировали стехиометрию связывания, которая варьировалась от 4 до 5 в зависимости от используемого аминогликозида, что указывает на то, что они связываются неспецифически через pre-miR-21. Почти идентичные стехиометрии связывания были получены как для 3 , так и для 4 (немеченый по сравнению с FRET-меченым, соответственно) (таблица S3).

Схема анализа связывания Interbase-FRET

Наш анализ на основе FRET для изучения связывания малых молекул с пре-миР основан на оценке комплексной эмиссии меченых парами FRET (tC O и tC nitro , включенных, донорно-акцепторная, DA) последовательность пре-миР до и после добавления лиганда по сравнению с тем же, что и для FRET-содержащей последовательности пре-миР (включен tC O , только донор, D) (см. Материалы и Уравнения методов.1–4). Лиганд добавляют к FRET-меченому pre-miR и измеряют изменение эмиссии DA-цепи по сравнению с соответствующей D-цепью. Эффективность FRET рассчитывается как доля интегрированного излучения последовательностей DA и D (уравнение 1). Затем разницу в FRET до и после добавления лиганда (Δ FRET , уравнение 2) нормализуют между двумя различными экспериментами по связыванию лиганда (см. С5).Среднее значение Δ FRET норма для двух разных наборов FRET-меченых олигорибонуклеотидов (усредненное значение Δ FRET норма , уравнение 4) используется для ранжирования лигандов (ранг FRET) в диапазоне от сильных до менее сильных связующие для экранированного набора малых молекул (таблицы 2 и S6).

Ранг аффинности аминогликозидов к pre-miR-21, определенный с помощью анализа interbase-FRET

Для получения значительного изменения FRET аминогликозиды (таблица 2 и рисунок S2) были добавлены к последовательностям 5 8 (таблица 1 ) в концентрации, соответствующей 90% степени комплексообразования пре-миР-21.Более высокая степень комплексообразования потребует неприемлемых концентраций или объемов маточных растворов аминогликозидов. Олигонуклеотид, меченый петлей шпильки ( 5 , таблица 1), показал диапазон 2–5% со средним увеличением эффективности FRET на 3% (рисунок S4), тогда как олигонуклеотид, меченный стеблем ( 7 , рисунок S6) показали среднее увеличение на 5% (за исключением гигромицина, который вызывал снижение эффективности FRET при связывании; рисунок S6). Для контрольных последовательностей только для донора ( 6 и 8 , таблица 1) наблюдались небольшие изменения в эффективности FRET (рис. S5 и S7), что указывает на то, что локальное микроокружение донора изменяется при добавлении аминогликозидов.В совокупности результаты показывают, что аминогликозиды связываются с петлей шпильки и частями стержня FRET-меченых конструкций pre-miR ( 5 и 7 ) и вызывают лишь небольшие изменения в относительной ориентации/расстоянии донор и акцептор. Кроме того, эти результаты показывают, что ни один из аминогликозидов не связывается селективно с петлей шпильки или частями стебля меченых конструкций pre-miR ( 5 и 7 ), а скорее связывается со всей pre-miR.Это согласуется с соотношением связывания аминогликозидов:олигорибонуклеотидов 4–5:1, измеренным с помощью SPR. Это также согласуется с работой групп Arenz и Maiti, показывающих, что аминогликозидные антибиотики, такие как канамицин и стрептомицин, обычно ингибируют процессинг миРНК, опосредованный Dicer, путем неспецифического связывания с субстратом Dicer, пре-миР 15, 16 .

Вторая серия экспериментов по связыванию лигандов была разработана для изучения того, может ли наш анализ на основе FRET различать относительную аффинность связывания аминогликозидов (таблица 2, рисунок S2).Кроме того, мы хотели исследовать, будет ли Δ FRET для аминогликозидов коррелировать со значениями сродства SPR.

Аминогликозиды добавляли к 1 мкМ FRET-меченым pre-miR ( 5 и 7 ; таблица 1) и их соответствующим эталонным образцам только для доноров ( 6 и 8 ; таблица 1) при общей концентрации аминогликозидов. 15 мкМ, выбранный из SPR K d в качестве средней точки между сильнодействующими и недействующими связующими (таблица 2, рисунок S8-S11).Данные ясно показывают, что аминогликозиды с высоким сродством, такие как неомицин (среднее значение SPR K d  = 3,3 мкМ, таблица 2), вызывали относительно большое изменение эмиссии (среднее значение Δ FRET  = 0,043 для 5 5 5 5 5 5 ) вызывали относительно большое изменение 7 , Таблица 2). Напротив, аминогликозиды с более низким сродством, такие как стрептомицин (среднее значение SPR K d  = 124 мкМ, таблица 2), вызывали минимальные изменения эмиссии (среднее значение Δ FRET  = 0,006 для 5 и Таблица 2, для получения дополнительной информации см. Таблицу 2).В целом, этот эксперимент позволил нам отличить наиболее эффективные связующие с Δ FRET в диапазоне 0,02–0,04 от менее активных связующих с Δ FRET в диапазоне 0,000–0,02.

Путем сравнения усредненных значений Δ FRET нормы , основанных на обоих типах экспериментов FRET (добавление аминогликозида для достижения общей концентрации 15 мкМ и добавление аминогликозида для достижения степени комплексообразования 90%; последнее представляет почти насыщенный событие связывания и, следовательно, максимальное изменение FRET) и сортируя их от высокого к низкому, аминогликозиды ранжировали на основе FRET (таблица 2, рейтинг FRET, уравнение4). В целом ранг FRET хорошо совпадал с рангом SPR в данном классе аффинности лиганда (высокая, средняя и низкая), а экспериментальные ошибки двух методов были низкими. Как и в SPR, было обнаружено, что неомицин, сизомицин и тобрамицин обладают самым высоким сродством к pre-miR-21 (среднее K d  < 10 мкМ, таблица 2) с использованием анализа FRET. Амикацин, гентамицин, апрамицин, нетилмицин и канамицин А принадлежат к группе лигандов пре-миР-21 со средней аффинностью (в среднем 15–45 мкМ, таблица 2).Хорошая корреляция наблюдалась при построении журнала K d из SPR 4 против усредненного Δ FRET нормы (R 2  = 0,82, рисунок S4). Наконец, было обнаружено, что рибостамицин, генетицин, стрептомицин и гигромицин являются низкоаффинными связывающими веществами в SPR (в среднем K d  > 84 мкМ) и в нашем анализе FRET. Таким образом, наш анализ связывания между основаниями-FRET различает связывающие вещества с высокой, средней и низкой аффинностью так же хорошо, как и общепринятый метод SPR.

Помогают ли писателям гранты, профессорские звания и другие формы институциональной поддержки, но вредят писательству?

Набоков представляет собой раннее изображение проблемы, связанной с взаимодействием между писателем (поскольку оно было основано на его собственном опыте) и организацией, несмотря на относительно привилегированное положение Набокова как белого мужчины, наживающегося на американском антикоммунизме и еврофилии. С тех пор, с триумфом неолиберализма после окончания холодной войны, конфликт между художником и институцией только усилился.Наблюдается все большее расширение бюрократических требований, предъявляемых учреждениями к писателям в обмен на зарплату, а также настойчивое давление с целью повышения профессионализма, что делает придирчивость Пнина или его слащавые всплески совершенно невообразимыми в современных условиях.

Если только преподаватели не работают в одном из нескольких избранных мест, от писателей все чаще требуется, помимо их преподавательских обязанностей, посещать собрания, работать в комитетах и ​​быть на электронной почте 24/7. От них также ожидается, что в эпоху, когда студенты являются клиентами, университет — брендом, а все зависит от мнения, они часто откладывают в сторону любые знания и опыт, которые они могли бы приобрести, чтобы успокоить различные чувства своих клиентов.В противном случае, как в случае с профессором поэзии в Висконсине, подвергшимся нападению за учебный материал с ЛГБТ. содержание, можно подать в суд, чтобы поменять F на A.

Остается ли после этого время писать? Немного, если только писателю не удастся найти грант, а их немного, и большинство из них, скорее всего, благоприятствуют тем, кто уже достаточно успешен. Даже в Британии, чьи элитные университеты когда-то были домом для писателей с заплатами на локтях и в твидовых куртках, никогда не обремененных ожиданием производства — Э.Известно, что М. Форстер провел более двух десятилетий в качестве почетного члена Королевского колледжа в Кембридже, так и не опубликовав ни одного романа — технократическим администраторам удалось расширить свой контроль над писателями до удручающей степени.

Писательница Марина Уорнер несколько лет назад описала в двух разрушительных статьях для The London Review of Books возникший конфликт между художниками, пытающимися жить в двух мирах — «в университете и в собственной комнате». В ее рассказе об уходе с некогда престижной должности в Университете Эссекса фигурирует бывший военный вице-канцлер, централизованная система оценки под названием REF («Рамка исследовательского мастерства») и «Тариф ожиданий», напоминающие о том, что антиутопическое будущее уже наступило. здесь и существует уже некоторое время.

«Внешние гранты становятся единственным способом заработать свободное время, чтобы писать», — отмечает Уорнер. Они остаются таковыми для многих. Я знаю, что с благодарностью вспоминаю каждую организацию, которая дала мне грант на написание книг, — Общество авторов, Институт Рэдклиффа и Фонд Говарда в Брауне. Такие гранты больше, чем деньги; они представляют собой общее видение идеи, проекта, веру в сам процесс ухода в комнату для работы над книгой. И все же они не могут изменить того факта, что подача заявки на них является авантюрой, или того факта, что мы живем в мире, где учебные заведения требуют все больше и больше, пока можно не воскликнуть вслед за Пнином, что для писательства не осталось ничего. .

FRET-анализ отдельных клеток для идентификации оптимальных FRET-пар в Bacillus subtilis с использованием прототипа системы MEM-FLIM

Реферат

Белок-белковые взаимодействия можно изучать in vitro , т.е. с бактериальными или дрожжевыми двухгибридными системами или поверхностным плазмонным резонансом. В отличие от методов in vitro , исследований белок-белковых взаимодействий in vivo позволяют изучить пространственное и временное поведение таких взаимодействий в их природной среде.Одним из подходов к изучению белок-белковых взаимодействий in vivo является резонансная передача энергии Фёрстера (FRET). Здесь эффективность FRET выбранных пар FRET была изучена на уровне одной клетки с использованием сенсибилизированной эмиссии и микроскопии с визуализацией флуоресценции в частотной области (FD-FLIM). Для FRET-FLIM использовался прототип модулированной системы FLIM с электронным умножением, которая, насколько нам известно, является первой учетной записью FLIM в частотной области для анализа FRET в отдельных бактериальных клетках.Для выполнения FRET-FLIM мы сначала определили и сравнили лучшую пару флуоресцентных белков для FRET в Bacillus subtilis с использованием нового вектора интеграции, совместимого с BglBrick. Мы показываем, что GFP-tagRFP является отличной парой донор-акцептор для B . subtilis in vivo исследований FRET. В качестве доказательства концепции выбранные донорные и акцепторные флуоресцентные белки были слиты с использованием линкера, который содержал последовательность, распознающую протеазу вируса травления табака (TEV). Индукция TEV-протеазы приводит к потере эффективности FRET и увеличению времени жизни флуоресценции.Потерю эффективности FRET после индукции TEV можно проследить во времени в одиночных клетках с помощью покадровой микроскопии. Эта работа облегчит будущие исследования in vivo динамики белковых комплексов в одиночном B . subtilis клеток.

Образец цитирования: Detert Oude Weme RGJ, Kovács ÁT, de Jong SJG, Veening JW, Siebring J, Kuipers OP (2015) Анализ одноклеточных FRET для идентификации оптимальных пар FRET в Bacillus subtilis с использованием прототипа MEM- Система ФЛИМ.ПЛОС ОДИН 10(4): е0123239. https://doi.org/10.1371/journal.pone.0123239

Академический редактор: Sabato D’Auria, CNR, ИТАЛИЯ

Получено: 7 января 2015 г.; Принято: 1 марта 2015 г.; Опубликовано: 17 апреля 2015 г.

Авторское право: © 2015 Detert Oude Weme et al. Это статья в открытом доступе, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

Доступность данных: Все соответствующие данные находятся в пределах в статье и в базе данных Genbank под регистрационным номером KM009065.

Финансирование: J.W.V. поддерживается Программой молодых исследователей EMBO, стипендией VIDI (864.12.001) Нидерландской организации научных исследований, наук о Земле и жизни (NWO-ALW) и стартовым грантом ERC 337399-PneumoCell. О.П.К. был поддержан несколькими грантами STW (NWO), двумя грантами ЕС FW7: SynPeptide и BachBerry и R.D.O.W. и О.П.К. по специальному гранту SYSMO2 от ALW-NWO. Lambert Instruments B.V. оказала поддержку в виде заработной платы автору С.J., но не играл никакой дополнительной роли в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи. Конкретные роли этих авторов сформулированы в разделе «вклад авторов».

Конкурирующие интересы: S.J. является сотрудником компании Lambert Instruments B.V., чья компания имеет коммерческий интерес в продаже системы MEM-FLIM. Нет никаких дополнительных патентов, продуктов в разработке или продаваемых продуктов, которые нужно декларировать. Это не меняет приверженности авторов всем политикам PLOS ONE в отношении обмена данными и материалами.

Введение

Бактерии долгое время рассматривались как везикулы, заполненные белками без какой-либо внутренней организации. Однако цитозоль бактериальных клеток густонаселен [1], поэтому ожидается, что высокий уровень организации обеспечит правильное функционирование клеточных процессов. В последнее время растет интерес к выяснению потенциальной пространственной организации внутри бактериальных клеток. Большой объем работ по бактериям в настоящее время выявил пространственную организацию ДНК-белковых взаимодействий, локализацию белков и белок-белковые взаимодействия [2-5].Все больше изучаются белок-белковые взаимодействия при делении клеток, регуляторные взаимодействия и метаболические процессы.

Ранее методы изучения белок-белковых взаимодействий были либо косвенными (например, двухгибридные дрожжи или бактерии), либо методами in vitro (например, поверхностный плазмонный резонанс). Эти методы практичны для скрининга потенциальных партнеров по взаимодействию или для изучения сродства связывания. Чтобы получить представление о динамике этих взаимодействий, метод in vivo должен производить информацию с временным разрешением.Резонансная передача энергии Фёрстера (FRET) позволяет контролировать белок-белковые взаимодействия с временным разрешением. FRET-анализ отдельных клеток позволяет исследовать индивидуальные различия белок-белковых взаимодействий, а не изучать среднюю эффективность FRET в популяции.

Флуоресцентная микроскопия позволяет идентифицировать только совместную локализацию белка из-за ее ограниченного разрешения. FRET представляет собой безызлучательный перенос энергии от возбужденного донорного флуорофора к акцепторному флуорофору, который может происходить только тогда, когда донор и акцептор находятся в непосредственной близости друг от друга (<10 нм).Таким образом, FRET является полезным инструментом для доказательства взаимодействий посредством возбуждения донорного флуорофора и измерения эмиссии акцепторной молекулы [6–8].

FRET был впервые описан Ферстером [9–11] и нашел широкое применение в молекулярной биологии [12,13] с момента появления различных флуоресцентных белков (FP) [14]. FRET успешно применяется для демонстрации взаимодействий между белками, т.е. для изучения сборки дивисомы в Escherichia coli [15] и состава Bacillus subtilis компетентностного аппарата [16].Для успешного эксперимента FRET есть три требования. Во-первых, донорный и акцепторный флуорофоры находятся в пределах 1–10 нм друг от друга. Во-вторых, спектр излучения донора перекрывается со спектром возбуждения акцептора, в-третьих, флуорофоры имеют сходную ориентацию диполей [11]. Хотя спектральное перекрытие необходимо, оно также является недостатком, поскольку акцептор может быть возбужден светом, используемым для возбуждения донора, вместо того, чтобы возбуждаться безызлучательной передачей энергии.Также излучение донора может проходить через фильтр акцепторного излучения. Потенциал протекания донора и акцептора требует коррекции путем визуализации образцов только с донорским или акцепторным флуорофором [6]. Другим способом преодоления проблем с просачиванием, вызванных спектральным перекрытием, является измерение времени жизни флуоресценции донорного флуорофора в присутствии или в отсутствие акцептора. Популяция возбужденных флуорофоров демонстрирует характерное затухание спонтанного излучения.

В этом исследовании эффективность FRET определялась двумя способами: первый метод заключается в обнаружении сенсибилизированного излучения [6]: измерение излучения акцептора, возникающего в результате резонансной передачи энергии от возбужденного донора.Второй метод заключается в измерении времени жизни флуоресценции, которое определяется как время, необходимое для снижения интенсивности флуоресценции до 1/e (приблизительно 37%) от начальной интенсивности сразу после возбуждения [17] и обычно находится в наносекундном диапазоне. Все, что гасит флуоресценцию — предлагает (больше) вариантов безызлучательного затухания, как это делает FRET — уменьшит время жизни флуоресценции [18].

Микроскопия времени жизни флуоресценции

в частотной области (FD-FLIM) [11,17–19] позволяет определять время жизни флуоресценции в широком поле с помощью фазовой модуляции [17].Для FD-FLIM свет возбуждения модулируется, что приводит к модулированному сигналу излучения. Время жизни исследуемого флуорофора вызывает задержку фазы модулированного излучения по сравнению с фазой модулированного возбуждения. Модулируя чувствительность детектора на той же частоте, что и сигнал возбуждения, можно измерить фазовую задержку между испусканием и возбуждением и рассчитать время жизни флуоресценции в каждом пикселе изображения. FD-FLIM позволяет быстро регистрировать время жизни флуоресценции в широком поле и отлично подходит для цейтраферной микроскопии и, таким образом, анализа FRET с временным разрешением.См. Чжао и др. . [20] и учебник Лаковича [17] для подробного объяснения FD-FLIM.

Здесь мы исследовали, какая пара FRET лучше всего подходит для динамических исследований белок-белковых взаимодействий в одиночных клетках грамположительной модельной бактерии B . subtilis [21]. Несколько генов, кодирующих флуоресцентные белки с потенциально хорошими свойствами FRET, клонировали попарно, интегрировали в локус amyE , экспрессировали и тестировали на свойства FRET.FP были ковалентно связаны с линкером, содержащим последовательность узнавания протеазы TEV. Индуцибельный ген протеазы TEV был клонирован совместно с парой FRET, что позволило получить условные ситуации с высокой/низкой эффективностью FRET. Эффективность FRET определяли с помощью сенсибилизированного излучения и с помощью прототипа системы MEM-FLIM. Доступные в настоящее время системы FD-FLIM используют усилитель изображения, фотокатод которого модулируется на высоких частотах (МГц). Усилитель изображения обычно является ограничивающим фактором для пространственного разрешения и подвержен повреждению при высокой интенсивности света.Поэтому запись FLIM трудно автоматизировать и она уязвима. Прототип системы MEM-FLIM, используемый здесь, модулирует ПЗС-датчик детектора непосредственно на уровне пикселей [20], в результате чего получается широкопольная система FLIM, которую можно легко интегрировать в автоматизированные установки микроскопии для покадровой микроскопии для изучения. динамика белок-белковых взаимодействий. Кроме того, что более важно, повышенного пространственного разрешения достаточно для FRET-FLIM для отдельных бактериальных клеток. Насколько нам известно, это первое исследование, которое включает анализ FD-FLIM отдельных бактериальных клеток на широкопольном микроскопе.

Материалы и методы

Бактериальные штаммы, плазмиды, олигонуклеотиды и условия роста

Штаммы, плазмиды и олигонуклеотиды, используемые в этом исследовании, перечислены в Таблице 1, Таблице 2 и Таблице 3 соответственно. Escherichia coli MC1061 использовали для клонирования. Все штаммы культивировали на среде LB (Lysogeny Broth) при 37°C с добавлением 100 мкг/мл ампициллина или 100 мкг/мл спектиномицина, когда это необходимо. Для покадрового эксперимента использовалась химически определенная среда.

Методы рекомбинантной ДНК

Очистку

ДНК, рестрикцию и лигирование проводили, как описано ранее [22]. Ферменты рестрикции Fast Digest, ДНК-полимеразу Phusion и ДНК-лигазу Т4 получали от Fermentas (St. Leon-Rot, Германия). Синтетическая ДНК была заказана у Mr. Gene (Регенсбург, Германия).

Плазмидная конструкция

В этом исследовании новый B . Вектор интеграции subtilis , pDOW01, был сконструирован путем модификации pDR111 (любезный дар Дэвида Руднера).Оба вектора интегрируются хромосомно в локусе amyE . Стандарт сборки BglBrick [23] был введен в pDR111, что привело к pDOW01, чтобы облегчить клонирование биологических частей.

Кроме того, последовательность, кодирующую сайт узнавания протеазы TEV (ENLYFQG), вставляли в качестве линкера в середину сайта клонирования BglBrick. Сайт клонирования BglBrick с сайтами рестрикции EcoR I, Bgl II, BamH I и Xho I всегда остается присутствующим во время клонирования для осуществления вставки новой части вверх или вниз по течению в существующую конструкцию.Стратегия клонирования BglBrick адаптирована из метода клонирования BioBrick [24].

Для создания pDOW01 из pDR111 были внесены следующие изменения: ORI для E . coli был заменен ORI на E . coli из pUC18 для удаления сайтов рестрикции Bgl II и Xho I, Amp R был удален, сайты рестрикции BglBrick [23] введены для клонирования, а сайт узнавания TEV-протеазы введен в середина сайта клонирования BglBrick.

Гомологические области гена amyE и маркера спектиномицина из pDR111 (от 115 до 4707) и E . coli ориджин репликации (1888–2583) из вектора pUC18 подвергали ПЦР-амплификации, включая сайты рестрикции Nco I и Spe I в последовательностях праймеров для объединения фрагментов в pDR-pUC-гибрид (см. Таблицу 3). для праймеров). Затем с помощью ПЦР Quikchange (Agilent) удалили сайт BamH I в положении 745 с праймерами pDR111_quikchange_FW и pDR111_quikchange_REV.Часть между 2100–2528 п.н. в исходном векторе pDR111 была переработана in silico и заказана у Mr. Gene (Регенсбург, Германия) со следующими изменениями. Сайты Xho I, Bgl II и EcoR I удаляли с помощью точечной мутации. Сайт Sal I удаляли и в восходящем направлении вставляли RBS со спейсером в семь п.н. до стартового кодона. За стартовым кодоном следовали префикс BglBrick, сайт узнавания TEV-протеазы, суффикс BglBrick, два стоп-кодона и строгая терминаторная последовательность.IPTG-индуцируемый промотор P hyper-spank из pDR111 оставался неизменным. Синтетическая ДНК была встроена в гибрид pDR-pUC путем замены исходных 422 п.н. между сайтами Sph I и Pst I на синтетическую ДНК из 529 п.н. посредством рестрикции и лигирования. Этот последний этап клонирования привел к нашему основному вектору клонирования, pDOW01 (рис. 1). Недавно сконструированная плазмида была полностью повторно секвенирована, и последовательность плазмиды была представлена ​​в базу данных Genbank под номером доступа KM009065.

Рис. 1. Карта вектора интеграции amyE pDOW01 с сайтом клонирования BglBrick, EcoR I, Bgl II, BamH I и Xho I выделены курсивом.

Жирным шрифтом выделены RBS (AGGAGG), сайт распознавания TEV-протеазы (GAGAATTTGTATTTTTCAGGGT; аминокислотная последовательность ENLYFQG) и два стопкодона (TAATAA).

https://doi.org/10.1371/journal.pone.0123239.g001

Конструкция плазмиды – вставка флуорофора

В этом исследовании использовались следующие флуоресцентные белки: Cerulean (голубой FP [25]), Venus (желтый FP [26]), sfGFP(Sp) [27], mCherry (красный FP [28], кодон оптимизированы DSM, как описано ранее [27]), mKate2 (дальнекрасный FP, Евроген) и tagRFP (красно-оранжевый FP, Евроген).Оптимизацию кодонов проводили для sfGFP, mCherry, mKate2 и tagRFP, как описано ранее [27].

pDOW01 использовали в качестве базового вектора для конструирования следующих пар FRET и их донорных и акцепторных аналогов: Cerulean-Venus, GFP-mCherry, GFP-mKate2, GFP-tagRFP и Venus-mCherry. Cerulean и Venus являются улучшенными версиями CFP и YFP [25,26]. Пары были выбраны для использования в качестве пары FRET на основе спектральных свойств [29] (см. также: http://www.microoscopyu.com/).

Все гены, кодирующие флуоресцентные белки, амплифицировали с помощью ПЦР с префиксом BglBrick ( EcoR I, Bgl II) в прямом праймере и суффиксом BglBrick ( BamH I, Xho I) в обратном праймере для вставка в pDOW01 (см. Таблицу 3).Для проверки последовательности конструкции использовали секвенирование.

Два флуорофора были связаны друг с другом линкерным пептидом, содержащим сайт узнавания TEV-протеазы. Сайт узнавания TEV-протеазы представляет собой ENLYFQ-G [30,31] с сайтом расщепления между аминокислотами глутамина и глицина. Б . Используемый здесь штамм subtilis DOW01 содержит индуцируемую TEV-протеазу (таблица 1). Ген TEV-протеазы под контролем промотора Pxyl, индуцируемого ксилозой, амплифицировали из BSG104 (праймеры, конструкция TEV_FW и конструкция TEV_REV), вставляли в pDG1664 и интегрировали в локус thrC локуса B . subtilis геном [32].

После клонирования флуорофоров в pDOW01 полученные конструкции трансформировали и интегрировали в локус amyE B . субтилис . Чтобы облегчить трансформацию, B . subtilis был сделан естественно компетентным, как описано ранее [33]. Единичная копия, двойная рекомбинация конструкций подтверждалась отсутствием активности (альфа)-амилазы на чашках с крахмалом LB.

Вестерн-блоттинг

Ночная культура B . subtilis разводили в свежей среде до приблизительной OD 600 0,03 и выращивали в течение 2 ч при 37°C при встряхивании при 225 об/мин. После индукции 0,1 мМ IPTG культуры разделяли на два равных объема и к одной части добавляли 1% (вес/объем) ксилозы для индукции TEV-протеазы. Клетки выращивали еще 2 часа при 37°С и 2 мл клеточной культуры центрифугировали (1 мин, 10000 об/мин) и ресуспендировали в 200 мкл 50 мМ Трис-Cl, рН 7,4. Лизис клеток был достигнут путем добавления к смеси стеклянных шариков (<106 микрон, Sigma) на кончике небольшого шпателя с последующим взбиванием мини-шариков два раза по одной минуте (Mini-Beadbeater-16, продукты Biospec).После центрифугирования (2 мин, 10 000 об/мин) супернатант осторожно переносили в чистые пробирки и хранили при -20°С. 30 мкл супернатанта, дополненного SDS-загрузочным буфером, кипятили при 80°C в течение 10 минут и наносили на 12% гель SDS-PAGE. После завершения электрофореза гель переносили на мембрану PVDF для вестерн-блоттинга (Roche. Один час при 80 мА) с последующим блокированием 5% (вес/объем) обезжиренного молока (Oxoid) в PBST (58 мМ Na 2 HPO). 4 , 17 мМ NaH 2 ПО 4 , 68 мМ NaCl, 0.1% (об./об.) Tween20, pH 7,3) в течение ночи при 4°C. ПВДФ-мембрану промывали три раза по 15 минут в PBST и инкубировали с PBST с 5% обезжиренным молоком и анти-GFP в разведении 1:10000 (кроличья сыворотка, Invitrogen Molecular Probes) в течение двух часов при комнатной температуре. Мембрану промывали три раза по 15 минут в PBST и инкубировали с PBST, дополненным пероксидазой хрена козьего антикроличьего Ig 1:5000 (Amersham Biosciences), в течение 1,5 часов при комнатной температуре. Затем мембрану трижды промывали, осторожно сушили салфетками и инкубировали в течение двух минут с 2 мл реагента для обнаружения ECL (GE Healthcare).Визуализацию сигнала проводили с помощью Molecular Imager ChemiDoc XRS+ (BioRad).

Флуоресцентная микроскопия

Спецификация микроскопа.

Визуализация под микроскопом для экспериментов с сенсибилизированным излучением была сделана с использованием микроскопической системы Personal DeltaVision (Applied Precision, Issaquah, USA) с программным обеспечением Softworx 3.6.0. Микроскоп был оснащен корпусом инвертированного микроскопа Olympus IX71, 100-кратным фазово-контрастным объективом (Olympus PlanApo 1.40 NA), камерой CoolSNAP HQ2 (Princeton Instruments), ксеноновым источником света мощностью 300 Вт и фильтрами для визуализации CFP (напр.430/24 нм; Эм. 472/30 нм), GFP (например, 470/40 нм; исправлено 525/50 нм) и mCherry (например, 572/35 нм; исправлено 632/60 нм) от Chroma. Для Cerulean и Venus использовалось полихромное зеркало CFP/YFP/mCherry (диапазон Chroma, 460–500, 525–575, 590–680 нм), а для GFP, mCherry, mKate2 и tagRFP использовалось полихромное зеркало GFP/mCherry ( Цветность, диапазон 400–470, 490–570, 580–630 и 640–730 нм). Изображения были получены с выдержкой света 0,2 с и светопропусканием 32% для каждой комбинации фильтров. Канал FRET был установлен в программном обеспечении с использованием фильтра возбуждения CFP или GFP и фильтра излучения GFP или mCherry.

Получение штамма и сверхэкспрессия белка

Среду

LB инокулировали при температуре -80°C B . subtilis запасов и выращивали в течение ночи при 37°С. На следующее утро культуры разводили 1 к 50 до приблизительной OD 600 0,03 в свежей среде LB и выращивали в течение двух часов при 37°C при 225 об/мин. Клетки индуцировали 0,1 мМ IPTG, и одну часть культуры, содержащую два флуорофора, переносили в новую бутыль, содержащую 1% (вес/объем) ксилозы, для индукции TEV-протеазы.После дополнительных двух часов инкубации клетки переносили на предметное стекло микроскопа, содержащее 1% (масса/объем) агарозы, для иммобилизации клеток, и измеряли интенсивность флуоресценции с помощью широкопольного микроскопа, описанного выше, для обнаружения FRET посредством сенсибилизированного излучения. Тот же метод подготовки образцов был применен для экспериментов FLIM, описанных ниже.

Сенсибилизированное излучение – Подготовка штамма для покадровой съемки

Интервальную микроскопию проводили, как описано ранее [34].Вкратце, среду LB инокулировали из стоков при температуре -80°C и выращивали в течение 8 часов при 37°C и 225 об/мин. Затем культуру разводили в 100 раз в среде определенного химического состава (CDM; с добавлением соли Спизизена [35], на литр: 2 г (NH 4 ) 2 SO 4 , 14 г K 2 HPO 4 , 6 г KH 2 PO 4 , 1 г Na 3 цитрат.2H 2 O, 0,27 г MgSO 4 .7H 2 мг Omed, аминокислоты 2 L-триптофана и 5 г D-фруктозы) и выращивали в течение ночи при 37°C, 225 об/мин.На следующее утро культуру разводили до OD 600 0,08 в свежем CDM, выращивали в течение 5-7 часов при 37°C и 225 об/мин до OD 600 приблизительно 0,7. Теперь (0,35/OD)*250 = 125 мкл клеток разводили в 500 мкл свежей среды и 2 мкл переносили на предметное стекло с 1,5% легкоплавкой агарозы (Sigma) в CDM и 0,1 мМ IPTG. Когда необходимо было экспрессировать ген TEV-протеазы, в среду для предметных стекол также добавляли 1% (вес/объем) ксилозы. Чтобы убедиться, что флуорофоры присутствуют с самого начала покадрового эксперимента, IPTG (конечная концентрация 0.1 мМ) добавляли к жидкой культуре за час до переноса на предметное стекло с агарозой. В случае необходимости экспрессии TEV-протеазы в жидкую среду также добавляли 1% (вес/объем) ксилозы. Предметное стекло с агарозой было разделено на три колонки, разделенные воздушными полостями; один для B . subtilis DOW5 (только GFP), один для B . subtilis DOW13 (только tagRFP) и один для B . subtilis DOW23 (тег GFP RFP).

Таймлапс делался на 16 часов с 15-минутным интервалом.Для каждого штамма были сделаны те же самые четыре изображения: фазовый контраст (пропускание света GFP), FRET (возбуждение GFP, эмиссия mCherry), донор (возбуждение и эмиссия GFP) и акцептор (возбуждение и эмиссия mCherry). Во всех случаях время воздействия света составляло 0,2 с, светопропускание — 32 %. Установка микроскопа была такой же, как описано выше, за исключением источника света, который теперь представлял собой твердотельное освещение TruLight (Applied Precision, Issaquah, USA). Микроскоп имел столик с программным управлением для регулярного посещения выбранных точек во время покадрового эксперимента, а DeltaVision UltimateFocus использовался для удержания клеток в фокусе.

Сенсибилизированное излучение – Анализ данных

Три биологически независимых образца были использованы для получения в общей сложности восьми изображений, необходимых для обнаружения FRET посредством сенсибилизированного излучения и его поправок [6]: B . subtilis клеток только с донором, только с акцептором и с донором и акцептором (табл. 4). Эти образцы только с одним из флуорофоров необходимы для расчета поправочного коэффициента для донора в акцепторном канале и наоборот, а также для поправки на просачивание (т.е. неспецифические события возбуждения и эмиссии в каналах флуорофорного фильтра-партнера).

Здесь FRET проводили с флуоресцентными белками, которые были связаны друг с другом сайтом расщепления TEV-протеазы. Индукция TEV-протеазы будет расщеплять флуорофоры и, как ожидается, приведет к снижению эффективности FRET.

ImageJ (http://rsb.info.nih.gov/ij/index.html) использовался для измерения интенсивности пикселей B . subtilis ячеек и Microsoft Excel для обработки данных.Во-первых, интенсивность фонового пикселя вычиталась из интенсивности клеточного пикселя и вычислялись четыре поправочных коэффициента для коррекции спектрального перекрытия (уравнения 1–4). Буквы в уравнениях 1–6 [6] относятся к символам в таблице 4.

(Уравнение 1)(Уравнение 2)(Уравнение 3)(Уравнение 4)

α корректирует флуоресценцию акцептора в донорном канале, γ представляет собой поправку на эффективность возбуждения акцептора светом возбуждения донора, δ корректирует сенсибилизированное излучение обратно в донорный канал, β – поправка на флуоресценцию донора в акцепторном канале [6].Эти факторы использовали для коррекции просачивания флуорофоров.

FRET был рассчитан по уравнению 5 [6] по сенсибилизированному излучению акцепторного флуорофора на изображении S (таблица 4). Вычитание βD из S удаляет донорный вклад в акцепторный канал, вычитание (γ-αβ)A необходимо для коррекции прямого возбуждения акцептора, и изображение масштабируется путем деления на 1-βδ.

(Уравнение 5)

Для расчета эффективности FRET сенсибилизированное излучение из уравнения 5 делится на интенсивность флуоресценции акцептора, A (уравнение 6 [6]).Полученная эффективность FRET, Ea, не зависит от интенсивности флуоресценции, которая может меняться со временем из-за уровней экспрессии белка.

(Уравнение 6)

Микроскопия флуоресценции в частотной области с визуализацией в течение всего срока службы

Используемая система MEM-FLIM в частотной области (Lambert Instruments BV) [20] состоит из источника света с несколькими светодиодами, содержащего светодиоды мощностью 3 Вт с пиковой интенсивностью при 446 нм (для Cerulean) и 469 нм (для GFP), генератора сигналов. и прототип ПЗС-камеры с прямой модуляцией. Система MEM-FLIM была установлена ​​на инвертированном микроскопе Nikon Eclipse Ti со 100-кратным масляным фазово-контрастным объективом (1.40 НС). Комбинации фильтров, используемые для визуализации Cerulean, были ex. 436/20 нм; Эм. 480/40нм и для GFP em. 480/30 нм; бывший. 535/40 (Никон). Эритрозин B (Sigma-Aldrich 87613), производное флуоресцеина, с временем жизни 0,086 нс использовали в качестве эталона. Эритрозин В растворяли в H 2 O и использовали в концентрации, соответствующей яркости образцов. Система MEM-FLIM работала с использованием программного обеспечения LI-FLIM версии 1.2.24 (Lambert Instruments B.V.).

фазово-контрастных изображения были получены с использованием пропускающего света и 0.Время экспозиции 1с. Данные FLIM были собраны с использованием времени экспозиции 0,7 с и модулированного светодиодного света для возбуждения. Данные о времени жизни флуоресценции собирали с использованием частоты модуляции 40 МГц. Для получения данных о времени жизни флуоресценции отдельных клеток использовали дополнительное 1,5-кратное увеличение на микроскопе Nikon, а время экспозиции для получения изображений флуоресценции было увеличено до 1,5 с. Программное обеспечение LI-FLIM использовалось для расчета времени жизни флуоресценции по данным фазового сдвига, см. Zhao et al .[20] для подробностей.

Акцептор фотоотбеливания

Акцепторное фотообесцвечивание

проводили, как описано ранее [36]. Вкратце, для всех штаммов были сделаны следующие снимки: три снимка до обесцвечивания со следующими настройками фильтров: фазовый контраст, возбуждение и эмиссия донора, возбуждение и эмиссия акцептора, теперь обесцвечивался акцептор в течение одной минуты при 100% светопропускании с использованием mCherry, а затем были сделаны три снимка после обесцвечивания со следующими настройками фильтров: фазовый контраст, возбуждение и испускание донора, возбуждение и испускание акцептора.ImageJ использовали для определения интенсивности флуоресценции донора до и после отбеливания акцептора. Фотографии были сделаны для штамма, содержащего только донора ( DOW05 ), и для штамма с донором и акцептором ( DOW23 ) с индукцией и без индукции гена, кодирующего протеазу tev .

Эффективность FRET можно рассчитать по уравнению 7 [36].

(Уравнение 7)

I DA представляет собой интенсивность флуоресценции донора в присутствии акцептора, а I DA* представляет собой интенсивность флуоресценции донора после фотообесцвечивания акцептора.

Результаты

Наблюдения за FRET отдельными клетками, обнаруженные с помощью сенсибилизированного излучения

Целью этой работы было определить лучшую FRET-пару и выполнить FRET на уровне одной ячейки в B . subtilis с помощью флуоресцентной микроскопии. Следовательно, пригодность различных флуоресцентных белков (FP) для целей FRET в B . subtilis тестировали путем экспрессии их попарно и ковалентно связанными. Здесь тестировались FP Cerulean (голубой FP [25]), Venus (желтый FP [26]) и sfGFP(Sp) [27] в качестве донора и tagRFP (красно-оранжевый FP, Evrogen), mCherry (a красный FP [28]) и mKate2 (дальний красный FP, Evrogen) в качестве акцептора.Соответствующие гены были клонированы в локусе amyE B . subtilis под контролем IPTG-индуцируемого промотора P hyper-spank с использованием недавно сконструированного вектора интеграции amyE pDOW (рис. 1), который обеспечивает эффективную сборку BglBrick [23] (рис. 2A).

Рис. 2. (A) Вектор интеграции amyE pDOW23 с FRET-парой GFP-tagRFP.

(B) Схематическое изображение двух флуоресцентных белков и линкера, содержащего сайт узнавания TEV-протеазы (ENLYFQG).(C) Вестерн-блоттинг, показывающий расщепление связанных флуорофоров протеазой TEV. Белок GFP визуализировали с помощью хемилюминесценции с GFP-антителами. Дорожки содержат бесклеточный экстракт из следующих штаммов: дорожка 1, DOW05 ( thrC::Pxyl-tev amyE::gfp ), дорожка 2, DOW13 ( thrC::Pxyl-tev amyE::tagRFP ), дорожка 3, DOW23 ( thrC::Pxyl-tev amyE::gfp-tagRFP ) из культуры без индукции гена протеазы tev и дорожка 4, DOW23 ( thr -tev amyE::gfp-tagRFP ), в котором ген протеазы tev индуцировали 1% (мас./об.) ксилозы.Прогнозируемые размеры мономера GFP и tagRFP составляют 27 кДа, а комплекса 55 кДа.

https://doi.org/10.1371/journal.pone.0123239.g002

Измерение как высокой, так и низкой внутриклеточной эффективности FRET необходимо для сравнительного анализа методологии, используемой в этом исследовании. Ковалентно связанные пары флуорофоров были сконструированы с использованием линкера, который содержит сайт узнавания протеазы TEV (фиг. 2В). Функциональность TEV-протеазы была проверена до того, как был начат поиск лучшей пары FRET, чтобы убедиться, что протеаза способна отделить два флуорофора друг от друга.Индукция протеазы TEV должна вызывать разобщение пары FRET, что приводит к потере сенсибилизированной эмиссии акцептора. Вестерн-блоттинг со специфическими антителами к GFP проводили для визуализации присутствия и размера белков, содержащих GFP. Как показано на рис. 2C, дорожка 3, синтетический димер GFP-tagRFP был легко получен. При индукции гена tev гетеродимер эффективно расщеплялся на мономеры GFP и tagRFP (дорожка 4). Экспрессия гена tev была немного неплотной, что приводило к присутствию мономерного GFP без индукции экспрессии tev (третья дорожка).Предполагается, что полоса около 37 кДа на дорожке 3 является продуктом деградации димера. В целом эти результаты показывают, что индукция гена tev -протеазы приводит к эффективному разделению пары FP (рис. 2C, дорожка 4).

Процесс сбора и анализа данных для расчета эффективности FRET показан на изображениях отдельных ячеек пары FRET GFP-tagRFP (рис. 3 и таблица 4). Сначала клетки только с донором и только с акцептором визуализировали под микроскопом в трех каналах (рис. 3A–3D2).Затем клетки с донором и акцептором (пара FRET) визуализировали в тех же трех каналах как с индукцией TEV-протеазы, так и без нее (рис. 3E-3G). Обратите внимание на значительное снижение флуоресценции акцептора (рис. 3F) в присутствии TEV-протеазы. Вклады эмиссии донора в акцепторном канале (рис. 3Б) и возбуждения акцептора возбуждением донора (рис. 3С) были очень малы, но тем не менее эти вклады необходимо учитывать, поскольку этот свет в FRET-канале не за счет сенсибилизированного излучения акцептора.После измерения интенсивности флуоресценции всех клеток (рис. 3) эффективность FRET, измеренная с помощью сенсибилизированного излучения, была рассчитана по уравнению 6.

Рис. 3. Интенсивность флуоресценции одиночных клеток для FRET-пары GFP-tagRFP.

Настройки фильтра возбуждения и эмиссии микроскопа указаны в скобках (d = донор, a = акцептор). Для донора фильтрами (возбуждение, эмиссия) были: GFP, GFP; для акцептора: mCherry, mCherry; а для FRET фильтрами были: GFP, mCherry. Во всех случаях использовалось полихромное зеркало GFP/mCherry (диапазон 400–470, 490–570, 580–630 и 640–730 нм).A и B представляют собой клетки, в которых присутствует только донорский флуорофор (GFP). C, D и D2 представляют собой клетки, в которых присутствует только акцепторный флуорофор (tagRFP). E, F и G (верхняя панель) представляют собой клетки, в которых донорно-акцепторный флуорофор (GFP-tagRFP) связан, а TEV-протеаза не индуцируется. E, F и G (нижняя панель) представляют собой клетки, в которых донор-акцептор (GFP-tagRFP) разобщается посредством индукции TEV-протеазы. Для всех изображений используется одинаковое масштабирование сигнала. Обратите внимание, что сигналы имеют ложный цвет (GFP: зеленый, tagRFP: красный). Масштабная линейка составляет 5 мкм.

https://doi.org/10.1371/journal.pone.0123239.g003

Эффективность FRET различных пар флуорофоров, обнаруженных с помощью сенсибилизированного излучения, показана в таблице 5. Следующие критерии использовались для выбора наиболее подходящей пары FRET из различных комбинации FP: во-первых, уровни сигнала к шуму отдельных флуоресцентных белков должны быть высокими (таблица 6), чтобы можно было изучить локализацию и динамику отдельных белков, слитых с данным флуоресцентным белком.Во-вторых, разница в эффективности FRET между ковалентно связанными и расщепленными флуорофорами должна быть высокой. Самые высокие уровни сигнал-шум для отдельных флуорофоров наблюдались в случае GFP, mKate2 и tagRFP (таблица 6). Поэтому GFP был выбран в качестве донора FRET в последующих экспериментах по межбелковому взаимодействию. Лучшими акцепторами оказались tagRFP и mKate2. Квантовый выход составил 0,48 против 0,40 [29,37], а относительная яркость 142 против 74 для tagRFP и mKate2 соответственно (в процентах от EGFP) [29].Оба флуорофора являются мономерными [29], но более высокий квантовый выход tagRFP облегчит исследования взаимодействия белков с tagRFP для FRET-анализа посредством сенсибилизированного излучения, поскольку большая часть резонансной энергии, передаваемой донором акцептору, приведет к излучению от акцептора [38]. ].

На основании критериев флуоресценции с высоким сигналом к ​​шуму и большой разницы в эффективности FRET между связанными и расщепленными флуорофорами GFP-tagRFP был выбран в качестве лучшей пары FRET в B . subtilis (табл. 5). Как интенсивность флуоресценции, так и эффективность FRET комбинаций Cerulean-Venus, GFP-mCherry и Venus-mCherry были намного ниже, чем у комбинаций GFP-mKate2 или GFP-tagRFP; поэтому эти пары были исключены из дальнейшего анализа.

Обнаружение FRET посредством сенсибилизированного излучения может быть подтверждено фотообесцвечиванием акцептора

Для поддержки представленного выше метода обнаружения FRET с помощью сенсибилизированного излучения был проведен эксперимент по фотообесцвечиванию акцептора на паре флуорофоров GFP-tagRFP.Эффективность FRET можно определить с помощью фотообесцвечивания акцептора [36]. Когда происходит FRET, молекула акцептора гасит флуоресценцию донора (что приводит к снижению флуоресценции донора), но когда акцептор разрушается фотообесцвечиванием, он больше не может тушить донора, поэтому можно обнаружить усиление флуоресценции донора.

Для специфического фотообесцвечивания tagRFP мы поместили живые клетки под микроскоп и воздействовали излучением 572/35 нм со 100% выходной мощностью твердотельного освещения TruLight в течение одной минуты.Это привело к снижению флуоресценции tagRFP на 35%.

Действительно, при использовании пары GFP-tagRFP эмиссия донора (GFP) была ниже, когда происходит FRET, чем когда GFP и tagRFP разъединяются TEV-расщеплением. Интенсивность флуоресценции GFP до отбеливания составляла: 362 AU без протеазы TEV по сравнению с 437 AU при продукции TEV. Более того, после фотообесцвечивания акцептора наблюдалось увеличение флуоресценции донора при сочетании GFP-tagRFP: интенсивность флуоресценции GFP составляла 410 AU (увеличение на 13%) при сочетании GFP-tagRFP по сравнению с429 AU (уменьшение на 1,8%), когда GFP-tagRFP был разъединен. Акцепторное фотообесцвечивание увеличивает флуоресценцию GFP на 13%, когда флуорофоры были связаны друг с другом. Когда флуорофоры были разобщены TEV-протеазой, флуоресценция донора была примерно одинаковой до и после фотообесцвечивания (437 против 429), что является хорошим контролем для этого метода.

Эффективность FRET E (см. уравнение 7) составляет = (410–362)/410 = 0,12 для GFP-tagRFP в этом эксперименте по фотообесцвечиванию акцептора.

В целом мы показали, что пара GFP-tagRFP может эффективно использоваться в качестве пары FRET для белковых взаимодействий в живых B . subtilis клеток.

Динамика эффективности FRET в покадровых экспериментах

Это исследование сосредоточено на поиске подходящих FRET-пар для изучения временного поведения белок-белковых взаимодействий. Пара GFP-tagRFP FRET использовалась в покадровом эксперименте, чтобы определить, является ли эффективность FRET стабильной с течением времени. Как ковалентно связанный, так и обработанный TEV-протеазой GFP-tagRFP обеспечивают постоянную эффективность FRET (рис. 4). Таким образом, были исключены процессы, изменяющие эффективность FRET, такие как неравномерная деградация белка.Любая динамика эффективности FRET, обнаруженная в будущих экспериментах по взаимодействию белок-белок, может быть связана с данным взаимодействием белок-белок.

Рис. 4. Эффективность FRET, Ea, определялась во времени с помощью эксперимента с интервальной флуоресцентной микроскопией.

Ковалентно связанный GFP-tagRFP, т.е. отсутствие TEV-протеазы приводит к высокой эффективности FRET (красная линия), а когда GFP-tagRFP разъединяется путем индукции гена, кодирующего TEV-протеазу, это приводит к низкой эффективности FRET (черная линия).Столбики погрешностей показывают стандартное отклонение трех повторных экспериментов. В каждый момент времени анализировали не менее 50 одиночных клеток.

https://doi.org/10.1371/journal.pone.0123239.g004

ЛАД-ФЛИМ

Время жизни флуоресценции GFP само по себе составляло 2,56 нс (табл. 7). Когда GFP был связан с акцептором, время жизни флуоресценции уменьшалось, т.е. 2,22 нс для GFP-tagRFP, а когда GFP и акцептор были разобщены экспрессией TEV-протеазы, время жизни флуоресценции GFP снова увеличивалось (таблица 7).Однако время жизни флуоресценции GFP в несвязанной паре FRET не увеличилось обратно к ситуации только GFP, что может указывать на то, что расщепление флуорофоров не было 100%.

Эффективность FRET можно рассчитать по времени жизни флуоресценции с помощью уравнения 8 [39]. (Уравнение 8) где τ DA — время жизни флуоресценции донора в присутствии акцептора, а τ D — время жизни флуоресценции в отсутствие акцептора. Самая высокая эффективность FRET составила 11% и была получена для GFP-mKate2 и GFP-tagRFP, эффективность FRET для GFP-mCherry составила всего 4%.Время жизни флуоресценции Cerulean определить невозможно из-за технических ограничений (неподходящие фильтры на установленном микроскопе MEM-FLIM).

Клетки

, содержащие GFP-tagRFP, использовались для изучения возможности использования прототипа системы MEM-FLIM для измерений FRET-FLIM на уровне одной бактериальной клетки (рис. 5). В верхней части рис. 5 клетки со связанными флуорофорами, клетки с несвязанными флуорофорами или смесь клеток со связанными и несвязанными флуорофорами окрашивались в ложные цвета с помощью справочной таблицы из программного обеспечения LI-FLIM.Используя сценарий Matlab для автоматической сортировки клеток, эти клетки были разделены на две группы на основе значений времени жизни флуоресценции; клетки с коротким временем жизни были ложно-голубыми, а с длинным временем жизни — ложно-пурпурными; пороговое значение было установлено на 2,3 нс (рис. 5A2-5C2). Этот сценарий также использовался для построения гистограммы времени жизни флуоресценции (рис. 5D). Гистограмма подтверждает, что клетки на рис. 5C2 содержали клетки с коротким и длительным временем жизни флуоресценции. Это показало, что прототип MEM-FLIM позволяет использовать FLIM для отдельных бактериальных клеток и может разрешать время жизни флуоресценции между отдельными людьми.

Рис. 5. Измерения одиночных ячеек FLIM.

(А1) В . Показаны клетки subtilis , где связаны флуорофоры GFP-tagRFP. (В1) В . Представлены клетки subtilis , где расщеплены флуорофоры GFP и tagRFP. (С1) В . Клетки subtilis , к которым присоединены флуорофоры GFP-tagRFP, смешивают в соотношении 1:1 с B . клеток subtilis , в которых расщеплены флуорофоры GFP-tagRFP; в результате получается смесь клеток либо с коротким временем жизни флуоресценции GFP из-за тушения с помощью tagRFP, либо с длинным временем жизни флуоресценции GFP.Визуализация клеток в A1, B1, C1 была выполнена с помощью Look-Up-Table от LI-FLIM. A2, B2 и C2 представляют одни и те же ячейки, но теперь для разделения ячеек на две категории использовался сценарий Matlab: ячейки с коротким временем жизни GFP показаны голубым цветом, а ячейки с длительным временем жизни GFP показаны пурпурным цветом. (D) гистограмма времени жизни флуоресценции клеток, описанных в A2-C2, черные, голубые, пурпурные и пунктирные линии представляют только GFP_only, связанные флуорофоры, расщепленные флуорофоры и смесь двух популяций соответственно.Масштабная линейка составляет 5 мкм.

https://doi.org/10.1371/journal.pone.0123239.g005

Обсуждение

Межмолекулярный FRET-анализ позволяет in vivo исследовать белок-белковые взаимодействия. Он был успешно применен для изучения сенсорных киназ CitA и DcuS в E . coli [40] и белки деления Fts в E . coli [15]. Белки из компетентного оборудования B . subtilis были изучены с помощью акцепторного фотообесцвечивания [16] и пути хемотаксиса у E . coli также широко изучался с акцепторным фотообесцвечиванием [41], но акцепторное фотообесцвечивание не позволяет исследовать динамику.

Здесь мы изучили, какая FRET-пара будет подходящим кандидатом для анализа in vivo FRET в B . субтилис . FRET, обнаруженный с помощью сенсибилизированного излучения, показал, что из протестированных пар пара GFP-tagRFP является лучшим кандидатом для целей FRET в B . subtilis на основе относительной яркости и квантового выхода tagRFP (см. также раздел результатов). Более ранняя работа показала пригодность пар GFP-tagRFP и GFP-mCherry FRET в клетках HeLa [38,42]. Однако наблюдаемая эффективность FRET в B . subtilis является низким для GFP-mCherry с использованием как сенсибилизированного излучения, так и FLIM (таблицы 5 и 7), несмотря на то, что спектральное перекрытие между GFP и mCherry велико, а также интенсивность флуоресценции высока. В случае сенсибилизированного излучения низкая эффективность FRET для комбинации GFP-mCherry также может быть результатом метода расчета, использованного в нашем исследовании (уравнение 6).Деление на A — интенсивность флуоресценции акцептора — приводит к более низкой эффективности FRET для GFP-mCherry, потому что A намного выше для GFP-mCherry, чем для GFP-tagRFP или GFP-mKate2 (таблица 6). Однако данные измерений FLIM не зависят от интенсивности, а данные FRET-FLIM подтверждают данные экспериментов по сенсибилизированному излучению (таблицы 5 и 7). В обоих случаях GFP-mKate2 и GFP-tagRFP являются двумя лучшими парами FRET.

GFP-mCherry часто используется в качестве пары FRET в исследованиях взаимодействия с высокой эффективностью FRET.В этом исследовании может оказаться, что свойства линкера препятствуют правильной ориентации обоих флуорофоров, что приводит к низкой эффективности FRET для этой FRET-пары. Эффективность FRET зависит от трех критериев получения FRET. Из этих критериев только спектральное перекрытие не зависит от используемой конструкции. Расстояние между флуорофорами и относительная ориентация молекул донора и акцептора зависят от последовательности линкера. Следовательно, эффективность FRET, представленная здесь, отражает ситуацию с расщепляемым протеазой линкером TEV.FRET-эффективность в более ранних работах колеблется от 4 до 46% [15,16,40,43].

По отдельности флуоресцентные белки продуцируются эффективно (Таблица 6), и, когда они связаны вместе, пара GFP-tagRFP имеет самую высокую эффективность FRET. Преимущество FRET-пар с красным смещением согласуется с более ранней работой [38,44], и одним из возможных объяснений является больший радиус Фёрстера [44].

Используемая здесь установка FRET-FLIM позволяет измерять эффективность FRET на уровне одной бактериальной клетки (рис. 5).Это показывает потенциал этой системы для изучения гетерогенности белок-белковых взаимодействий. На данный момент прототип ПЗС-сенсора имеет ограниченную чувствительность, позволяя проводить FLIM только для отдельных бактериальных клеток с высоко экспрессированными парами FRET, и поэтому пока не может широко применяться для исследований на бактериях. Однако, когда слитые белки находятся под контролем сильных промоторов, соответствующие данные могут быть получены даже для обычно низкоэкспрессируемых белков. В качестве альтернативы, улучшенные системы могут быть включены в существующие установки микроскопии, позволяющие быстро считывать FRET во время e.г. цейтраферная микроскопия или микрожидкостные эксперименты для изучения динамики белок-белковых взаимодействий.

Вклад авторов

Задумал и разработал эксперименты: RGJDOW ATK JWV JS OPK. Проведены эксперименты: RGJDOW. Проанализированы данные: RGJDOW. Предоставленные реагенты/материалы/инструменты для анализа: JWV OPK. Написал статью: RGJDOW ATK SdJ JWV JS OPK.

Каталожные номера

  1. 1. Мика Дж.Т., Ван ден Богаарт Г., Винхофф Л., Красников В., Пулман Б.(2010) Молекулярно-ситовые свойства цитоплазмы кишечной палочки и последствия осмотического стресса. Мол микробиол 77: 200–207. пмид:20487282
  2. 2. Уэйд Дж. Т., Струл К., Басби С. Дж., Грейнджер Д. С. (2007) Геномный анализ взаимодействий белок-ДНК у бактерий: понимание транскрипции и организации хромосом. Мол Микробиол 65: 21–26. пмид:17581117
  3. 3. Шапиро Л., МакАдамс Х.Х., Лосик Р. (2009) Почему и как бактерии локализуют белки. Наука 326: 1225–1228.пмид:19965466
  4. 4. Руднер Д.З., Лосик Р. (2010)Субклеточная локализация белков у бактерий. Cold Spring Harb Perspect Biol 2: a000307. пмид:20452938
  5. 5. Маршадье Э., Карбаллидо-Лопес Р., Бринстер С., Фабрет С., Мервеле П., Бессьер П. и др. (2011)Расширенная сеть межбелковых взаимодействий в bacillus subtilis выявляет группу концентраторов: исследование с помощью интегративного подхода. Протеомика 11: 2981–2991. пмид:21630458
  6. 6. Ван Райнен Дж., Лангеслаг М., Ялинк К.(2004) Корректировка конфокальной съемки для оптимизации визуализации переноса энергии флуоресцентного резонанса посредством сенсибилизированного излучения. Биофиз J 86: 2517–2529. пмид:15041688
  7. 7. Гордон Г.В., Берри Г., Лян Х.Х., Левин Б., Герман Б. (1998) Количественные измерения переноса энергии флуоресцентного резонанса с использованием флуоресцентной микроскопии. Биофиз J 74: 2702–2713. пмид:95
  8. 8. Надь П., Вамози Г., Боднар А., Локетт С.Дж., Соллоси Дж. (1998) Измерения переноса энергии на основе интенсивности в цифровой микроскопии изображений.Европейская биофизика J 27: 377–389. пмид:96
  9. 9. Фёрстер Т. (1948) Межмолекулярная миграция энергии и флуоресценция. Аннален дер Физик 2: 55–75.
  10. 10. Страйер Л. (1978) Перенос энергии флуоресценции как спектроскопическая линейка. Annu Rev Biochem 47: 819–846. пмид:354506
  11. 11. Лакович Дж.Р. (2006) Принципы флуоресцентной спектроскопии. Нью-Йорк: Спрингер.
  12. 12. Ремингтон С.Дж. (2011) Зеленый флуоресцентный белок: перспектива.Белковая наука 20: 1509–1519. пмид:21714025
  13. 13. Криват Г., Тараска Ю.В. (2012)Визуализация белков внутри клеток с помощью флуоресцентных меток. Тенденции биотехнологии 30: 8–16. пмид:21924508
  14. 14. Shaner NC, Steinbach PA, Tsien RY. (2005) Руководство по выбору флуоресцентных белков. Нат-методы 2: 905–909. пмид:16299475
  15. 15. Алексеева С., Гаделла Т.В. младший, Верхул Дж., Верховен Г.С., ден Блааувен Т. (2010)Прямые взаимодействия белков раннего и позднего деления сборки в клетках кишечной палочки разрешены с помощью FRET.Мол микробиол 77: 384–398. пмид:20497333
  16. 16. Kramer N, Hahn J, Dubnau D. (2007) Множественные взаимодействия между компетентными белками bacillus subtilis. Мол Микробиол 65: 454–464. пмид:17630974
  17. 17. Лакович Дж.Р. (2006) Измерения времени жизни в частотной области. В кн.: Анонимные принципы флуоресцентной спектроскопии. Нью-Йорк: Спрингер. стр. 157.
  18. 18. Мюнстер vEB, Гаделла TWJ. (2005) Микроскопия флуоресцентной визуализации времени жизни (FLIM), глава 5.В: Шепер Т, редактор. Достижения в области биохимической инженерии / биотехнологии. стр. 143–175.
  19. 19. Ван Мюнстер Э.Б., Гаделла Т.В. мл. (2004) phiFLIM: новый метод, позволяющий избежать наложения спектров в микроскопии с изображением жизни флуоресценции в частотной области. Дж. Микроск 213: 29–38. пмид:14678510
  20. 20. Чжао К., Шелен Б., Схоутен Р., ван ден Овер Р., Леенен Р., ван Куйк Х. и др. (2012)Микроскоп с модулированным электронным умножением флуоресценции для визуализации времени жизни: полностью твердотельная камера для визуализации времени жизни флуоресценции.J Biomed Opt 17: 126020. pmid:23323290
  21. 21. Кунст Ф., Огасавара Н., Мозер И., Альбертини А.М., Аллони Г., Азеведо В. и др. (1997) Полная последовательность генома грамположительной бактерии bacillus subtilis. Природа 390: 249–256. пмид:9384377
  22. 22. Сэмбрук Дж., Фрич Э.Ф. и Маниатис Т. (1989) Молекулярное клонирование: лабораторное руководство. Нью-Йорк: Издательство лаборатории Колд-Спринг-Харбор.
  23. 23. Андерсон Дж. К., Дьюбер Дж. Э., Легия М., Ву Г. К., Голер Дж. А., Аркин А. П. и соавт.(2010) BglBricks: Гибкий стандарт сборки биологических деталей. J Biol Eng 4: 1. pmid:20205762
  24. 24. Найт Т. (2003) Дизайн идемпотентного вектора для стандартной сборки биокирпичей. Доступно: http://web.mit.edu/synbio/release/docs/biobricks.pdf. Доступ: ноябрь 2010 г.
  25. 25. Риццо М.А., Спрингер Г.Х., Гранада Б., Поршень Д.В. (2004) Улучшенный вариант голубого флуоресцентного белка, полезный для FRET. Nat Biotechnol 22: 445–449. пмид:149

  26. 26. Нагаи Т., Ибата К., Пак Э.С., Кубота М., Микошиба К., Мияваки А.(2002) Вариант желтого флуоресцентного белка с быстрым и эффективным созреванием для клеточно-биологических применений. Нац. биотехнология 20: 87–90. пмид:11753368
  27. 27. Оверкамп В., Бейлхарц К., Детерт Оуде Веме Р., Солопова А., Карсенс Х., Ковач А.Т. и др. (2013) Сравнительный анализ различных вариантов GFP у Bacillus subtilis, Streptococcus pneumoniae и Lactococcus lactis для визуализации живых клеток. Appl Environ Microbiol 79: 6481–6490. пмид:23956387
  28. 28. Шейнер Н.К., Кэмпбелл Р.Е., Штайнбах П.А., Гипманс Б.Н., Палмер А.Е., Цзянь Р.Ю.(2004)Улучшенные мономерные красные, оранжевые и желтые флуоресцентные белки, полученные из Discosoma sp. красный флуоресцентный белок. Nat Biotechnol 22: 1567–1572. пмид:15558047
  29. 29. День Р.Н., Дэвидсон М.В. (2009) Палитра флуоресцентных белков: инструменты для визуализации клеток. Chem Soc Rev 38: 2887–2921. пмид:19771335
  30. 30. Догерти В.Г., Паркс Т.Д., Кэри С.М., Базан Дж.Ф., Флеттерик Р.Дж. (1989) Характеристика каталитических остатков 49-кДа протеиназы вируса травления табака.Вирусология 172: 302–310. пмид:2475971
  31. 31. Poyales DA, Goldstein A, Ward G, Hughes AJ Jr. (1994)TEV-протеаза, рекомбинантная: сайт-специфическая протеаза для эффективного расщепления аффинных меток из экспрессированных белков. Фокус 16: 1–5.
  32. 32. Грубер С., Вининг Дж. В., Бах Дж., Блеттингер М., Брамкамп М., Эррингтон Дж. (2014) Взаимосвязанные сестринские хромосомы возникают в отсутствие конденсина во время быстрой репликации у B. subtilis. Карр Биол.
  33. 33. Харвуд Ч.Р., Резка С.М.(1990) Рост, поддержание и общие методы. в harwood C.R. и Cutting S.M., молекулярно-биологические методы для бацилл , глава 1 и приложение 1. john wiley & sons, inc. Чичестер, Великобритания.
  34. 34. де Йонг И.Г., Бейлхарц К., Куйперс О.П., Вининг Дж.В. (2011)Визуализация живых клеток Bacillus subtilis и Streptococcus pneumoniae с использованием автоматизированной покадровой микроскопии. J Vis Exp 53: 3145. pmid:21841760
  35. 35. Анагностопулос К., Спицизен Дж.(1961) Требования к трансформации в bacillus subtilis. J Bacteriol 81: 741–746. пмид:16561900
  36. 36. Кенворти АК. (2001)Визуализация белок-белковых взаимодействий с использованием флуоресцентной резонансной микроскопии с переносом энергии. Методы 24: 289–296. пмид:11403577
  37. 37. Мерзляк Э.М., Годхарт Дж., Щербо Д., Булина М.Е., Щеглов А.С., Фрадков А.Ф., и соавт. (2007)Яркий мономерный красный флуоресцентный белок с увеличенным временем жизни флуоресценции. Нат-методы 4: 555–557.пмид:17572680
  38. 38. Щербо Д., Соуслова Е. А., Годхарт Дж., Чепурных Т. В., Гайнцева А., Шемякина И. И. и др. (2009)Практическая и надежная пара флуоресцентных белков FRET/FLIM. БМС Биотехнолог 9: 24-6750-9-24.
  39. 39. Лакович Дж.Р. (2006) Перенос энергии. В кн.: Анонимные принципы флуоресцентной спектроскопии. Нью-Йорк: Спрингер. стр. 443.
  40. 40. Шой П.Д., Витан Дж., Раушмайер М., Граф С., Ляо Ю.Ф., Эберт-Юнг А. и соавт. (2012) Двухкомпонентная система CitA/CitB, регулирующая ферментацию цитрата в кишечной палочке, и ее связь с системой DcuS/DcuR in vivo.J Bacteriol 194: 636–645. пмид:22101843
  41. 41. Кентнер Д., Сурджик В. (2009)Динамическая карта белковых взаимодействий в пути хемотаксиса кишечной палочки. Мол Сист Биол 5: 238. pmid:1

    30
  42. 42. Padilla-Parra S, Auduge N, Lalucque H, Mevel JC, Coppey-Moisan M, Tramier M. (2009) Количественное сравнение различных пар флуоресцентных белков для быстрого сбора данных FRET-FLIM. Биофиз J 97: 2368–2376. пмид:19843469
  43. 43. Ван дер Крогт Г.Н., Огинк Дж., Понсиоэн Б., Ялинк К.(2008) Сравнение пар донор-акцептор для генетически кодируемых FRET-сенсоров: применение к сенсору epac cAMP в качестве примера. PLoS One 3: e1916. пмид:18382687
  44. 44. Goedhart J, Vermeer JE, Adjobo-Hermans MJ, van Weeren L, Gadella TW Jr. (2007)Чувствительное обнаружение гомодимеров p65 с использованием пар FRET на основе красного смещения и флуоресцентных белков. PLoS One 2: e1011. пмид:17925859
  45. 45. Guerout-Fleury AM, Frandsen N, Stragier P. (1996) Плазмиды для эктопической интеграции в bacillus subtilis.Ген 180: 57–61. пмид:8973347
  46. 46. В.М. Кек Центр сотовой визуализации. Для обработки данных FRET требуется семь изображений. Доступно: http://www.kcci.virginia.edu/FRET/process/seven.php. Доступ: 2011.

Полное руководство по публикации в литературном журнале

Экология кучи слякоти (или С чем вы конкурируете?)

Начнем с того, как на самом деле работает публикация журналов, потому что этот процесс может быть несколько — и, вероятно, намеренно — непрозрачным.

Когда вы подаете заявку в литературный журнал, ваша работа попадает (буквально, если она отправлена ​​по почте, или фигурально, если она представлена ​​в электронном виде) в «кучу слякоти». Это не самое вдохновляющее название, оно вызывает в воображении образ гигантских куч грязного, полурастаявшего снега, небрежно сброшенного с дороги лопатами и плугами. На самом деле это может быть точной метафорой. Куча слякоти — это беспорядок. Великие истории рождаются из кучи слякоти, но они спрятаны среди полных опечаток тирад, третьесортных имитаций Рэймонда Карвера и хайку, написанных от руки на гостиничных салфетках.Хорошая часть слякоти заполнена работами, которые не соответствуют даже основным параметрам журнала: фантастические новеллы, отправленные по адресу Postmodern Poetry Review , и фанфики по ВК, отправленные по адресу Quiet Realism Monthly .

Большинство редакторов, вероятно, сочли бы, что по крайней мере 60% грязной кучи не подлежат публикации, и точка. (Многие говорили мне, что 80–90%, но я буду великодушен.) Двадцать процентов многообещающи, но требуют доработки, а 10% можно опубликовать, но не в журнале, в который они направляются.Остается 10% работы, которая может заслуживать реального рассмотрения.

Писатели, это действительно хорошая новость!

Большинство хороших журналов принимают около 1% работы, которую они получают. Но если вы знаете, что пишете работу, которая является последовательной, выверенной и соответствует тому, что публикует журнал, то вы попали в первые 10% с места в карьер… и 1/10 намного лучше шансов, чем 1/ 100.

Откуда берется остальная работа?

Работа, не связанная с грязной кучей, происходит либо из 1) предложений — когда редакторы активно отправляют письма авторам или их агентам с просьбой о работе, либо 2) из ​​материалов, отправленных агентами или писателями, имеющими отношение к журналу.Если вы были опубликованы в журнале или ваши материалы были близки к этому, они могут попросить вас представить вашу следующую работу в стопку чтения без слякоти. Для заказанной работы это обычно принимается, если только редактору она действительно не нравится или она действительно не подходит… отклонение запрошенной работы в основном считается плохим этикетом. Материалы, не содержащие слякоти, просто пропускают «раунд чтения» — подробнее об этом позже — и отправляются прямо в редакцию. Тем не менее, подавляющее большинство этих представлений будет отклонено.

Действительно ли журналы Lit Mags публикуют нежелательные работы?

Да.Нет. Ну, это зависит.

Литературные журналы охватывают весь спектр: от нишевых веб-журналов до печатных журналов, финансируемых университетами, и The New Yorker. Соответственно изменяется количество публикуемой слякоти. Я был бы удивлен, если бы Житель Нью-Йорка за последнее десятилетие опубликовал хотя бы три рассказа из кучи слякоти, но многие из наиболее уважаемых литературных журналов публикуются в основном из слякоти. За исключением нескольких крупных глянцевых журналов, которые все еще публикуют художественную литературу, большинство освещенных журналов публикуют где-то от 20% до 100% слякоти.Миф о том, что литературные журналы даже не читают слякоти, устойчив, но за пределами самых топовых журналов это действительно миф. Говоря лично, многие из моих самых больших публикаций появились из кучи слякоти без каких-либо связей или помощи. Это действительно происходит.

Хорошо, но публикуют ли они ранее неопубликованных авторов?

Неопубликованные писатели, по понятным причинам, обеспокоены тем, публикуют ли когда-нибудь журналы неопубликованных писателей. Короткий ответ: да. Каждый писатель начинал неопубликованным, и я знаю многих людей, у которых были свои первые публикации без какой-либо связи.Даже крупные журналы будут публиковать неопубликованных писателей. Парижское обозрение за короткий промежуток времени вытащили Башню Уэллс и Июнь Ли из слякоти. Gigantic посчастливилось стать первой публикацией для нескольких талантливых писателей.

Конечно, полностью неопубликованных писателей все реже можно найти в очереди на отправку, так как количество интернет-журналов, местных журналов и журналов колледжей — все это хорошо! — означают, что большинство писателей сначала публикуются где-нибудь в небольшом месте.

Я знаю публикующегося писателя, и она Никогда Покоряется слякоти

Это правда, что многие писатели не подчиняются слякоти. Если у вас за плечами несколько хороших публикаций или множество связей в литературном мире — или в мире фэнтези, если вы пишете фэнтези и т. д., — вы сможете опубликовать большую часть своей работы благодаря предложениям и/или связям. Тем не менее, большинство писателей начинают с подачи и таким образом получают большую часть своих первых публикаций.

Как очистить кучу слякоти?

Большинство журналов получают сотни, если не тысячи статей в год. Вот Бриджит Хьюз в 2004 году, бывший редактор The Paris Review и основательница A Public Space , которая говорит, что прежнее издание получало от 15 000 до 20 000 материалов в год. Я бы предположил, что это число увеличилось в эпоху цифровых представлений.

Даже небольшой журнал получает гораздо больше работы, которую они могут опубликовать, и, будем откровенны, гораздо больше работы, чем редакторы могут прочитать в режиме реального времени.Если редактор не собирается бросать свою повседневную работу — большинство редакторов освещенных журналов не получают денег за редактирование — никогда не читают для удовольствия, никогда не выполняют никаких редакционных обязанностей, кроме чтения представленных материалов, и получают все питательные вещества через внутривенные трубки… тогда они просто могут Читали слякоть сами.

Подавляющее большинство книг читают «читатели», которые в большинстве своем являются добровольцами, работающими неполный рабочий день, но могут также включать стажеров и других сотрудников. Если журнал прилагается к программе магистратуры, читатели, вероятно, являются студентами МИД.Если журнал обычно связан с университетом, он, вероятно, является старшекурсником. Добровольцы — это начинающие писатели или редакторы, или просто люди, которые любят литературу и имеют странную идею, что чтение случайных историй — это весело. Стандартная, но ни в коем случае не универсальная политика заключается в том, чтобы каждое представление было прочитано дважды. Если оба голоса «против», статья отклоняется до того, как это увидит начальство. Если он получает один или два утвердительных ответа, его передают редакторам и помощникам редакторов. Если редактору понравится, она будет опубликована.Бум. Простой.

Итак, мой рассказ полностью прочитают два человека?

Эээ… наверное нет. Опять же, из-за того, сколько часов в сутках по сравнению с размером кучи слякоти, даже читатели-добровольцы не могут прочитать больше пары страниц каждого материала. Если на первой странице нет ничего, что могло бы зацепить читателя, то, скорее всего, она получит голос «нет». Это просто перерывы. Это одна из причин того, почему учителя письма постоянно подчеркивают важность первой страницы, первого абзаца и первой строки.Пожалуй, это все, что было прочитано.


Это несправедливо! Моя история гениальна, но в конце становится только лучше!

Если вы склонны сказать, насколько это несправедливо по отношению к молодым писателям, спросите себя: на сколько литературных журналов, которые вы отправляете, вы подписываетесь? Если вы похожи на большинство писателей, вы, вероятно, подписаны на два литературных журнала, максимум. И это нормально. Я не буду ругать вас за то, что вы не тратите деньги на освещенные журналы, хотя лично я нахожу лучшие из них более увлекательными, чем большинство книг.Дело в том, что если журналы не получают денег, то у них нет денег, чтобы платить своим сотрудникам (тем более их авторам), а это значит, что они не могут позволить себе, чтобы опытные люди читали каждую статью.

Кроме того, если ваша история не может зацепить читателя-добровольца, вынужденного хотя бы взглянуть на вашу работу, каковы шансы, что случайный читатель будет захвачен? Если это не хорошо до конца, возможно, перепишите его, начиная с конца.

Ну, по крайней мере, все истории имеют равные шансы, верно?

Я участвовал во многих дискуссиях о публикациях и читал много эссе на эту тему.Линия партии, которой придерживаются редакторы, заключается в том, что все дело в работе, а не в том, насколько известен писатель, и что не имеет значения, неопубликованы ли вы или у вас есть агент. Тем не менее, всякий раз, когда аудитория задает вопросы о сопроводительном письме, редакторы говорят, что вы должны перечислить около трех ваших лучших публикаций, а также указать, были ли вы в МИД или имеете какие-либо другие письменные полномочия. И если у вас есть связь с журналом, упомяните и об этом. «Все помогает!»

Здесь довольно очевидное противоречие.Либо эти факторы не влияют на решение, либо влияют. Либо перечисление этого материала (или отправка агентом) помогает, либо нет. Хотя мои коллеги-редакторы могут бросить меня в задворки за то, что я сказал это, вот как эти вещи могут помочь:

1) Если в вашей заявке есть какие-то важные публикации или она связана с журналом, который вы указали в сопроводительном письме, тогда ваш отправка может миновать уровень читателя и попасть прямо в редакцию. Это преимущество, поскольку 95% работы отсеивается на этапе чтения.Это не означает, что, когда вы находитесь в руках редактора, ваша история будет принята с большей вероятностью, чем слащавая статья, которую пропустят, особенно в хорошем журнале, где они получают тонны материалов от агентов или известных писателей. Но вы не будете отклонены в первых раундах. Это как попрощаться на спортивном турнире.

2) Хотя я не думаю, что многие признают это, я верю, что если у вас впечатляющая биография, читатели с большей вероятностью будут внимательно читать вас.Читатели, как правило, начинают с литературного мира или являются просто студентами, которым нравится поэзия и художественная литература, и поэтому они с большей вероятностью не будут доверять их суждениям или не захотят потерять статью, которая может понравиться редактору. Что это означает практически? Как я объяснял выше, читатели могут прочитать только одну или две страницы, прежде чем принять предложение. Если они увидят, что в биографии есть хорошие публикации, то они могут прочитать 10 страниц истории, из которых в противном случае прочитали бы только одну. Если статья находится на грани, они с большей вероятностью пропустят ее (если куча других хороших журналов считает, что автор хорош, может быть, читатель что-то упускает?) Но, опять же, это не означает, что, как только она в руки редакторов он, скорее всего, будет принят, чем любой другой, попавший во второй тур.

Все Представления должны быть слепыми, так как важны только заслуги!

Писатели, редакторы и читатели любят говорить, что главное — это заслуги. Но если быть честными, то это не так. Во-первых, заслуга не существует полностью в вакууме. Новый рассказ лауреата Нобелевской премии будет иметь определенную силу и вызовет определенный интерес благодаря тому, кто его написал. Искусство субъективно, но даже если бы вы могли поставить какую-то «объективную» оценку, 6.2 рассказ Дэвида Фостера Уоллеса или Фланнери О’Коннор вполне может «стоить» больше, чем рассказ 6.2, написанный совершенно неизвестным.

Возможно, что более важно, журналы хотят, чтобы их читали, а читатели с гораздо большей вероятностью прочитают журнал, в котором есть хотя бы пара знакомых названий. Черт возьми, писатели, отправившие свои лучшие работы, с большей вероятностью отправят свои лучшие работы в журналы, которые публикуют писателей, чьи имена им известны. Большинство хороших редакторов пытаются найти баланс между продвижением новых и неопубликованных писателей и включением известных писателей, которые привлекут читателей, но вот так.

Ба, да это же все кумовство!

Несмотря на то, что я сказал выше, кумовство не обязательно работает, как думают большинство писателей. Часто возникает ощущение, что журналы просто помогают своим друзьям, публикуя их, но я думаю, что обратная ситуация может быть более распространенной: писатели отдают журналу своего друга работы, которые они могли бы продать на более крупном рынке.

Это опять же потому, что писателей и читателей привлекают журналы, в которых публикуются знакомые имена.Если вы хотите открыть новый литературный журнал, лучший способ привлечь к себе внимание — попросить (или заплатить) авторитетных писателей прислать вам свои работы.

Directed Evolution to Engineer Monobody для сборки биосенсора FRET и визуализации на поверхности живых клеток для разработки биосенсоров используется рациональный дизайн

PEbody может применяться для отслеживания динамики межклеточных контактов с высокой точностью ratio

Биосенсор выявляет гетерогенную активность MT1-MMP при межклеточных контактах

Резюме

Мониторинг ферментативной активности на клеточной поверхности затруднен из-за низкой эффективности транспорта и мембранной интеграции флуоресцентного резонанса биосенсоры на основе переноса энергии (FRET).Поэтому мы разработали гибридный биосенсор с отдельными донором и акцептором, которые собирают на месте . Технологии направленной эволюции и анализа функции последовательности были объединены для создания варианта монотела (PEbody), который связывается с красителем R-фикоэритрин (R-PE). PEbody использовали для визуализации динамического формирования/разделения межклеточных соединений. Далее мы объединили PEbody с усиленным CFP и фермент-специфическим пептидом на внеклеточной поверхности, чтобы создать гибридный биосенсор FRET после захвата R-PE для мониторинга активности матриксной металлопротеиназы мембранного типа 1 (MT1-MMP).Этот биосенсор выявил асимметричное распределение активности MT1-MMP, которое было высоким и низким при рыхлых и стабильных межклеточных контактах соответственно. Таким образом, направленная эволюция и рациональный дизайн являются многообещающими инструментами для разработки молекулярных связующих и гибридных биосенсоров FRET для мониторинга молекулярных регуляций на поверхности живых клеток.

Ключевые слова

Ключевые слова

Monobody

Monobodythratrin

R-PHYCOREERYTRIN

MT1-MMP

MT1-MMP

Cell-Culting Контакты

Направленные Evolution

Рекомендуемая статьи со стажению (0)

© 2018 Elsevier Ltd.

Рекомендуемые статьи

Ссылки на статьи

.

Добавить комментарий

Ваш адрес email не будет опубликован.

2019 © Все права защищены. Карта сайта