Газ м1 технические характеристики: ГАЗ М1 технические характеристики автомобиля

ГАЗ М1 технические характеристики автомобиля

ГАЗ М1 или просто Эмка — это известный советский автомобиль, который был наиболее ходовым 

легковым автомобилем в предвоенный период истории СССР. ГАЗ-М-1, 

«эмка» — знаковая модель довоенных и военных лет. 

Первая, собственно, разработанная техотделом завода имени Молотова новая машина. 

И хотя по договору 1929 года с «Фордом»

американский авто гигант передавая советской стороне документацию на свою перспективную

легковую модель, осваивать же её, создавать всю оснастку пришлось инженерам ГАЗа

самостоятельно. Таким образом они были избавлены от простого копирования нового «форда».

Работа по созданию М-1 началась в сентябре 1933 года, с переходом из HATH на ГАЗ главного

конструктора Андрея Александровича Липгарта.

При внешней схожести с седаном Ford-B 1934 модельного года ГАЗ-М-1 имел всё же своё

оригинальное шасси, отвечающее местным условиям — с более мощной рамой и Х-об- разным

усилителем, на четырех продольных рессорах вместо двух поперечных, со штампованными

колёсами вместо спицованных. Четырёхцилиндровый двигатель, форсированный по типу

«фордовского» до 50 л.с., отличался от мотора ГАЗ-А повышенной степенью сжатия, более

совершенным карбюратором, ново введёнными бензонасосом, водяным насосом, автоматом

опережения зажигания и системой смазки под давлением.

Постройка первого прототипа заняла всего четыре месяца. И к концу января 1934 года автомобиль

с покупным кузовом Ford на оригинальном шасси М-1 был готов. Вот как вспоминал о нём сам

Липгарт:

«Этот образец имел массу промахов и по- строен был отвратительно. На машине можно было

ездить только чрезвычайно осторожно, так как её рама, сваренная из кусков (не сумели достать

длинных листов), могла переломиться. Об испытаниях не могло быть и речи. И всё же эта машина

принесла нам огромную пользу. На ней мы показали, какова по своему типу будет наша новая

модель, и получили одобрение этого типа от тов. Орджоникидзе. В процессе работы над этой

машиной мы учили конструкторов, и каждый из них получил возможность ви- деть детали,

выполненные по его чертежам, почувствовать эти детали, почувствовать достоинства и недостатки

своей работы».бронеавтомобилей. «Эмка» была желанной машиной в автопарках гражданских

учреждений и войсковых частей. Шофёры любили её за надёжность и прочность, простоту

обслуживания и латания дыр в железе, за непритязательность к сортовому топливу и

удовлетворительную проходимость, за какой ни есть, но не продуваемый комфорт. Производство

М-1 было прервано в конце августа 1941 года, но мелкосерийная сборка из оставшихся в заделе

запчастей продолжалась вплоть до января 1942 года. Всего было выпущено 62888 автомобилей

ГАЗ-М-1. Один из них экспонируется в Музее истории ГАЗ в Нижнем Новгороде.


 

Годы выпуска: 1936-1943 гг.

Количество автомобилей: 62 888


  

Эксплуатационные характеристики
Максимальная скорость:105 км/ч
Объем бензобака:60 л
Расход топлива:14.5 л
Допустимая полная масса:1745 кг
Разгон с места до 100 км/ч24 c
Характеристики двигателя
Расположениеспереди, продольно
Объем двигателя3285 см3
Тип цилиндраРядный
Мощность двигателя50 л.с.
Количество оборотов2800
Система питаниякарбюратор
Диаметр цилиндра98.43 мм
Ход поршня107.95 мм
Степень сжатия4.6
Октановое число бензина59 — 65
Трансмиссия
Типмеханическая
К-во передач3
Передаточное отношение главной пары4.44
Приводзадний
Тормоза
ПередниеКолодочные
ЗадниеКолодочные
Кузов
Тип кузоваседан
Количество дверей4
Количество мест5
Длина машины4625 мм
Ширина машины1770 мм
Высота машины1775 мм
Колесная база2845 мм
Колея передняя1435 мм
Колея задняя1440 мм
Дорожный просвет (клиренс)210/235 мм

Советский автомобиль ГАЗ М1 «Эмка»: фото и технические характеристики

ГАЗ М1 — один из самых популярных автомобилей советской эпохи. Он производился в 30-40 годах прошлого столетия и собирался на заводе имени Молотова, который позже переименовали в Горьковский автозавод. За время существования модели ГАЗ М 1 было выпущено порядка 63 тысячи автомобилей, поэтому он считался одним из самых успешных за всю историю послевоенного СССР. Достичь таких же высот удалось только Москвичу и концерну ВАЗ (Лада).

Классический внешний вид и дизайн автомобиля ГАЗ М1


Во времена своего выпуска авто именовали просто — «Эмка», так как официально приставки ГАЗ еще не существовало (до 1962 года, когда Молотова исключили из партии, и уже в 63-м — отправили на пенсию). Вернуться к оглавлению

История создания «Эмки»

ГАЗ М1 был уникальным автомобилем, так как выпускался в военный период. Из-за этого некоторые модели собирались не из комплектных деталей. Поставки запчастей постоянно прерывались, тогда как выпуск авто прекращать нельзя было ни в коем случае. Вот мастера и выходили из ситуации любым возможным образом. За это сейчас и ценится автомобиль. Некоторые из них сейчас стоят свыше 100 тысяч долларов, так как являются уникальными и неповторимыми в прямом смысле слова. А базовый ГАЗ М1 на вторичном рынке можно приобрести всего за 2-3 тысячи долларов.

Базовый автомобиль Газ М1 Эмка для продажи


Правда, тех, что остались на ходу и производились первые, не так и много. По большей части встречаются старые и изношенные развалюхи. М1 — это также советский автомобиль, который одним из первых получил статус «внедорожника» среди гражданских. Он действительно с легкостью выдерживал жесткие поездки по бездорожью. До этого подобной трансмиссией обладали разве что те автомобили, которые предназначались по большей части для армейских целей.
А Эмки, в свою очередь, частично взяли в свою конструкцию ГАЗ-А, что выпускался ранее (в начале 1930-х годов).

И, кстати, инженеры, которые работали над созданием и выпуском «Эмки», не отрицают, что в какой-то мере за основу взяли автомобиль Ford типа B, что впервые был выпущен в Соединенных Штатах в начале 1932 года. Более того, в ГАЗ М 1 использовали схожую систему комплектации кузова с изогнутыми передними крыльями.

Внешний вид автомобиля Ford B


Запасное колесо при этом крепилось в задней части кузова. Непосредственно перед разработкой ГАЗ М 1 командой советских инженеров и вовсе проводились испытания западного аналога — автомобиля Ford. Там же были выявлены его существенные недостатки, в числе которых архаичное шасси, работа фрикционных амортизаторов, общая комфортабельность. Эмка на потребительский рынок была выпущена уже без этих недостатков. Вернуться к оглавлению

Технические характеристики ГАЗ М1

В заводской комплектации ГАЗ М1 имел предустановленный 4-цилиндровый двигатель, общий объем которого составляет 3,2 литра. Предельная мощность — 50 лошадиных сил. Предельно возможная скорость — порядка 80 километров в час, до которой он разгонялся всего за 24 секунды. На свое время среди советского автопрома это были самые высокие показатели.


И несмотря на свой объемный двигатель, на 100 километров в смешанном режиме езды он потреблял всего 14,5 литров топлива. Довольно не плохо, если учитывать, что топливный бак был вместительностью в 60 литров и представлялась возможность поставить второй, дополнительный, объемом в 30 литров.

Клапанный механизм — SV, что было уже традиционно для того времени. Однако сам двигатель разрабатывался отдельно, где за основу была взята модель М. А вот охлаждение было жидкостным, без чего бензиновые двигатели и тогда не могли обойтись. Единственный минус мотора — это то, что блок цилиндров и все иные элементы механизма производились из чугуна. Кстати, заправляли авто тогда бензином А-66, производительность которого практически в 2 раза ниже того, который на заправках используется сейчас.

К сожалению, двигатель ГАЗ М не был чрезвычайно надежным.

двигатель для автомобиля ГАЗ М1


В нем довольно часто выходил из строя газораспределительный вал, отвечающий за своевременное открытие и закрытие впускных\выпускных клапанов. Из-за этого мощность мотора падала с увеличением степени изношенности. А строение карбюратора не позволяло толком отрегулировать период подачи топлива, поэтому приходилось часто полностью менять газораспределительный вал. Вернуться к оглавлению

Колесная база ГАЗ М1

ГАЗ М 1 обладал одной из лучших трансмиссий вообще на тот период, даже если сравнивать автомобили с европейскими и американскими аналогами, что часто встречались на потребительском рынке. Колесная база составляла 284 полных сантиметра, по ширине — 144 (спереди — на 5 миллиметров меньше). Максимально допустимая грузоподъемность составляет 500 килограммов. Естественно, что возможности буксировать прицеп у автомобиля не было.

Габариты и колесная база Эмки


Нужно упомянуть, что в Фаэтон, который являлся опытным образцом Эмки, колесная база была немного шире. Но это не удивительно — изначально автомобиль планировалось использовать для рабочего класса и в сельском хозяйстве. Чуть позже появилась вариации ГАЗ М1 пикап, с увеличенной грузоподъемностью до 700 килограммов (рассчитана на 2 человек). Правда, его выпуск в свое время был под срывом.

Эта Эмка пользовалась небывалым спросом благодаря своей высокой скорости передвижения, легкости, с которой она преодолевала бездорожье, и надежности кузова. Именно автомобиль ГАЗ использовался основным в сельском хозяйстве, но позже его заменили на модификации ГАЗ 61, который разрабатывался как раз на основе ГАЗ М1. Привод автомобиля был задним, хоть компоновка подразумевала размещение двигателя спереди.


Усилие, естественно, передавалось через продольный кардан. Невзирая на убеждение инженеров, что такая конструкция в ГАЗ м1 будет ненадежной — получилось очень даже хорошо. Стандартный ресурс эксплуатации автомобиля до первого ТО составлял порядка 6 тысяч километров. По тогдашним стандартам — очень высокий показатель.

Управлялась работа трансмиссией через трехступенчатую механическую коробку передач. К ней никаких нареканий нет — она была стандартной практически для всех автомобилей ГАЗ. Рычаг — изогнутый, практически полностью располагался в салоне. Технические характеристики ходовой в будущем полностью перекочевали в пикап. В нем был изменен лишь кузов, и добавлена новая развязка для вывода назад габаритных огней.

Вернуться к оглавлению

Кузов и салон автомобиля ГАЗ М1

Не секрет, что Эмка не только частично копировала техническую составляющую Ford модели B, но и кузов. Единственное отличие советского автомобиля — более качественная звукоизоляция, что была достигнута благодаря ручной сборке практически каждого транспортного средства, а также более толстый кузов. Последнее сделано нарочно, так как автомобиль планировалось эксплуатировать в более суровых условиях, в том числе при очень низкой температуре окружающей среды.

Передняя часть кузова в Пикап осталась аналогичной, а вот сзади добавили грузовую нишу открытого типа с усиленным каркасом. Это благодаря ему в ГАЗ М 1 грузоподъемность была увеличена до 700 килограммов. Вот только при такой нагрузке максимально возможная скорость передвижения составляла всего 55 километров в час.

Дизайн салона автомобиля ГАЗ М1


А вот салон «Эмки» был относительно простым. В качестве обшивки использовалась серая или черная шерстяная ткань довольно низкого качества. В более престижных вариациях автомобиля ее заменили на кожу, но таких автомобилей выпустили менее 320 штук и использовались они преимущественно в аппарате генерального секретаря КПСС. Немного погодя у него прижилось название М1 Звезда. К сожалению, до нынешнего момента сохранились всего несколько таких транспортных средств, они располагаются в музее концерна ГАЗ.

Еще салон не имел деревянных деталей, что для того времени было необычно. Вместо них использовался металл с покраской под дерево — традиционная на тот момент вариация отделки. Следует быть честным — салон американского Ford визуально выглядел куда более привлекательным, так как его обшивали дерматином, а сидения уже имели собственную амортизацию.

Модификация автомобиля Газ М1


Такая же система использовалась позже в М1 Звезда, что производились уже после Великой Отечественной Войны. А у Пикап салон обладал еще более отделкой. Более того, из завода в нем не были предусмотрены резиновые коврики. Вот поэтому часто историки упоминают, что в этих автомобилях использовалась соломенная подстилка — ее делали сами шоферы, которым доводилось заниматься перевозкой. Дешевое решение не большой проблемы. Вернуться к оглавлению

Будущая судьба ГАЗ М1

ГАЗ М1 выпускался на заводе Молотова включительно по 1943 год. Хотя некоторые источники указывают на то, что не малое количество моделей были выпущены и после 1946 года, но уже с немного видоизмененными техническими данными. Можно сказать, что те авто были прототипами ГАЗ 61. Салон в них остался идентичным, а двигатель уменьшился в объеме, оставив былую мощность Пикап выпускался и позже, но уже исключительно по правительственному заказу.

Вид сзади автомобиля газ М1 пикап


Например, большая их часть тогда эксплуатировались в восточных землях УССР и не только в сельском хозяйстве, но и в тяжелой промышленности. Окончательно Пикап прекратили выпускать только после 50-х годов, когда ГАЗ представил замену для Эмки в виде ГАЗ-61 (415 и 417 серий). Изначально ГАЗ М1 типа Пикап вообще планировалось заменить на ГАЗ-11, но тот в серийное производство так и не попал, так как был отвергнут самим Молотовым на этапе разработки.

По факту, Эмка прекратила свое существование в конце 50-х годов, хотя на советских дорогах они встречались еще до 70-х годов.

Чуть позже их ремонтировали, используя детали от ГАЗ-21. Именно такие экземпляры сейчас и реализуют под видом рабочих ГАЗ М 1. Но, по факту, это уже более современный автомобиль. Чуть позже планировалось выпустить версию такси.

газ м1 Эмка такси


При этом запасное колесо планировалось разместить в боковой части кузова, а сзади добавить дополнительный фонарь. Однако в серийное производство его не пропустили, а на дорогах использовался тот самый М1 Ударник с предустановленным таксометром. Они также широко применялись в Белорусской ССР, а в Москве курировали до 1946 года, после чего были выведены из эксплуатации, так как считались устаревшими моделями.

В начале сороковых годов появился еще и автомобиль ГАЗ вариации ГЛ-1. Это была модификация Эмки для гоночных соревнований. Правда, особого успеха она так и не достигла в спортивных состязаниях. В ней использовался форсированный двигатель М, мощность которого была увеличена аж до 100 лошадиных сил. Именно с его помощью чуть позже был установлен предельный рекорд скорости в 161 километров в час. Для тех времен — это просто неимоверно высокая цифра.


В 40-х годах планировалось выпустить и модель ГАЗ М1, в котором двигатель работал бы на сжиженном газе. К сожалению, выпустили только один автомобиль такого типа, который на данный момент хранится в НИИ автотракторной промышленности.

Технология была признана недоработанной, так как предельная мощность автомобиля падала до 30 лошадиных сил.

Этого было недостаточно для транспортировки 5 человек, на которых автомобиль был рассчитан. И это не говоря уже о модели Пикап, которая использовалась исключительно для перевозки груза. На текущий момент ГАЗ М1 в своей изначальной комплектации и на ходу (после реставрации, конечно же) хранится только в поселке Падиково, Московской области, в музее. Ежегодно ему устраивают обкатку на 20 километров для поддержания в нормальном техническом состоянии.

Вернуться к оглавлению

Замена автомобиля ГАЗ М1

Заменили настоящую легенду автомобилем ГАЗ-61, в котором привод был сделан уже на оба моста. Увеличен был и дорожный просвет, но сказать, что у него была лучше проходимость нельзя — она осталась на прежнем уровне. Единственное преимущество ГАЗ-61 как для потребителя — это салон, который модернизировали уже с учетом канонов от Ford. Первые модели выпускались еще во времена Великой Отечественной Войны, но активно производились и после ее окончания, когда завод ГАЗ (тогдашний Молотова) активно реконструировался.

Внешний вид автомобиля ГАЗ 61


Эмка по праву может называться самым популярным автомобилем военного и пост-военного времени, что подтверждается огромным тиражом (наибольшим на тот момент в СССР для одной модели). Автомобиль получился настолько удачным, что практически во всех последующих моделях от ГАЗ, выпускающихся вплоть до 60-х годов, использовались те или иные элементы из Эмки. Многие из них перекочевали в ГАЗ-21, ГАЗ-61-447.

Легковой автомобиль ГАЗ-М 1. СССР

Первым по-настоящему массовым советским легковым автомобилем стал ГАЗ-А, с открытым кузовом типа «кабриолет», являвшийся лицензионной копией американского автомобиля Ford-А, и выпускавшийся с 1932 г. по 1936 г. на Горьковском автомобильном заводе, а с 1933 г. по 1935 г. в Москве – на автомобильном заводе имени Коммунистического Интернационала Молодежи (КИМ). Однако уже вскоре стало ясно, что климатическим условиям на большей части территории СССР соответствуют автомобили с закрытыми кузовами, но попытки выпуска легковых автомобилей с кузовом типа «седан» собственной разработки на базе ГАЗ-А не привели к успеху, из-за использования в их производстве устаревшей каркасно-панельной технологии. Поэтому в феврале 1935 года на Горьковском автозаводе (ГАЗ) под руководством главного конструктора А.А. Липгарта началась разработка нового, более совершенного автомобиля с использованием технической документации на легковой автомобиль Ford Model B 40A 1934 года, полученной от американской фирмы Ford Motor Co на основании договора о технической помощи.

Новая советская автомашина, получившая обозначение «ГАЗ-М1», стала одним из символов своей эпохи, сыграв немаловажную роль в военные годы, поскольку она являлась одним из наиболее распространенных в Советском Союзе легковых автомобилей. В ходе адаптации конструкции Ford-40A к отечественным условиям производства и эксплуатации этот автомобиль был в значительной степени спроектирован советскими специалистами заново. Количество изменений по сравнению с конструкцией прототипа было столь значительным, что на Горьковском автозаводе эту модель уже считали своей собственной, хотя и созданной под иностранным влиянием. От американского прототипа ГАЗ-М1 отличался очень существенно. Он получил: более мощную раму, которую пришлось полностью переконструировать из-за радикального изменения подвесок – подвеска мостов имела четыре продольных рессоры вместо двух поперечных у «Форда»; шины низкого давления; штампованные колесные диски взамен спицованных. Его комфортабельный цельнометаллический закрытый четырехдверный кузов типа «седан», монтировался на жесткой лонжеронной X-образной раме и не воспринимал ударных нагрузок от дороги. Более совершенная и живучая подвеска передних и задних колес на полуэллиптических продольных рессорах снабжалась гидравлическими рычажными амортизаторами одностороннего действия. Впервые на советских автомобилях у него появился контактно-маслянный фильтр, автомат опережения зажигания и регулируемое сидение водителя. На автомобиле монтировался рядный четырехцилиндровый карбюраторный двигатель ГАЗ-М мощностью 50 л.с. Крутящий момент от двигателя передавался через однодисковое сцепление, трехступенчатую коробку передач со скользящей зубчатой муфтой, закрытый карданный вал с одним шарниром и коническую головную передачу. Автомобиль ГАЗ-М1 имел достаточно высокие скоростные характеристики. На шоссе он развивал скорость до 105 км/ч, для разгона с места до скорости 80 км/ч ему требовалось 24 секунды. Средний эксплуатационный расход топлива составлял 14,5 л на 100 км. В целом, автомобиль ГАЗ-М1 получился гораздо более продвинутым, по сравнению со своим американским прототипом, а по отдельным позициям превосходил и более позднюю продукцию фирмы Ford. Кроме того, советский автомобиль ГАЗ-М1 оказался намного лучше приспособленным к отечественным дорожным условиям, поскольку его проходимость по грунтовым дорогам была высокой. Поэтому, несмотря на то, что ГАЗ-М1 изначально позиционировался как гражданская модель легкового автомобиля, высокие ходовые характеристики этой машины позволили в 1936 году использовать его шасси для создания легкого бронеавтомобиля БА-20. Всего с 1936 по 1943 годы было выпущено 62888 автомобилей семейства ГАЗ-М1. Также эта машина выпускалась в варианте кабриолета и пикапа ГАЗ М-415 грузоподъемностью 500 кг, кроме того, производилась ее модель с шести-циллиндровым мотором – ГАЗ М-11-73 и полноприводный 4х4 вариант – ГАЗ 61. Автомобиль ГАЗ-М1 использовался как в народном хозяйстве, так и в Красной армии (в качестве командирских машин), а также в НКВД. В различных штабах и тыловых учреждениях Красной армии перед началом Великой Отечественной войны насчитывалось более 10500 легковых автомобилей ГАЗ-М1. В годы войны эти автомобили широко использовались в РККА для обслуживания командного состава: дивизионного, армейского и флотского звеньев.

Машины Победы: ГАЗ М-1 :: Автопортал Третий Рим

7 мая 2018

История легендарной «Эмки»


Александр Шаронов, фото ТАСС, sovietcars.net

На днях мир отпразднует 73 годовщину окончания Великой Отечественной войны. Подвиг предков навсегда останется в нашей памяти. Но не стоит забывать их верных помощников, без которых Победа была бы невозможной — «железных коней». В основном принято вспоминать легендарные модели танков, самоходных артиллерийских установок и самолетов, но мы сегодня поговорим о легковых автомобилях.

А начнем серию выпусков о Машинах Победы с «Эмки». Примечательно, что серийный выпуск ГАЗ М-1 продолжался относительно небольшую часть Великой Отечественной: на Горьковском автомобильном заводе ее собирали с 1936 по 1942 год.


Современники называли этот автомобиль преимущественно «Эмкой». При этом даже в литературе того времени данная модель обозначалась как «М-1» или «М1», то есть название завода чаще всего не упоминалось. Все дело в том, что тогда производитель называл несколько иначе: Нижегородский автомобильный завод имени Вячеслава Михайловича Молотова (главы правительства СССР и председателя Совнаркома). Так что имя «М-1» обозначало «Молотовский-первый».

Немного предыстории

Предшественником «Эмки» был первый советский массовый легковой автомобиль — ГАЗ-А. Он был лицензированной копией Ford Model A. А поскольку американский прототип был разработан еще в 20-х годах, да к тому же он был во многом аналогичен до предела упрощенному Ford Model T, то уже в 30-х стало остро ощущаться не только моральное, но и технической устаревание.

Однако еще неокрепшая советская экономика не могла позволить себе разработку полностью новой модели. Не хватало и инженерного опыта: к тому времени автомобильная промышленность СССР выпускала в основном копии американских машин. Немудрено, что в правительстве решили идти проверенной дорогой.

Выбор западного образца

Вряд ли в отношении процесса создания «Эмки» можно применить такие термины как «разработка» и «проектирование». Все же Нижегородский автомобильный завод взял уже готовый автомобиль и лишь слегка его доработал.

За основу был взят Ford Model B 40A Fordor Sedan образца 1934 модельного года. Этот автомобиль оснащался четырехцилиндровым мотором. Можно было выбрать восьмицилиндровый Ford Model 18, однако из соображений экономии было решено остановиться на младшей версии. При этом необходимо понимать, что даже с учетом двукратного преимущества по количеству цилиндров «восьмерка» не была двое производительнее. Удивительно, но два ДВС были практически идентичны по рабочему объему: 3,5 литра для L4 и 4,6 литра для V8. Мощность оценивалась в 50 и 65 лошадиных сил соответственно.


Ford Model B

Да, уже в то время миром автомобилей правил маркетинг! Принято считать, что маркетологи стали диктовать свои требования лишь в 2000-х годах, когда машины окончательно «испортились». Тем не менее, еще в 30-х годах прошлого века Ford перешел на V8 исключительно по маркетинговым соображениям: такие модели попросту считались более престижными.

Одним из ключевых отличий Ford Model B от Model A был практически полностью металлический кузов. Он был разработан компанией Ford при поддержке кузовостроительной фирмы Budd Company. Еще на этапе проектирования был продуман более эффективный производственный процесс, который позволял повысить скорость сборки и снизить издержки. Не в последнюю очередь именно эти факторы привлекли советскую сторону.

Перепроектирование

Несмотря на то, что Нижегородский автомобильный завод получил полностью готовый автомобиль, по договору с «Фордом» производитель получил в основном лишь документацию. Молодому советскому предприятию требовалось не только доработать модель под требования правительства и подготовить ее к серийному выпуску, но и создать часть производственного оборудования.


«Эмка»

Задача по адаптации Ford Model B легкла на плечи инженеров под руководством А. А. Липгарта. В состав коллектива были включены Л. В. Косткин, А. М. Кригер, В. И. Борисов, Ю. Н. Сорочкина, В. И. Подольский, Н. Г. Мозохин, И. В. Новоселов и Б. Д. Кирсанова. По инициативе Липгарта были сформулированы требования к отечественной версии «Форда». Специалистам требовалось довести надежность отдельных узлов и агрегатов до определенного уровня, который бы позволил продолжительно эксплуатировать транспортное средство с учетом советских реалий. Требовалось повысить проходимость машины и упростить ее ремонт и обслуживание, чтобы даже низкоквалифицированные рабочие справились с основными задачами.

Так была ли «Эмка» полной копией Ford Model B?

Разумеется, ГАЗ М-1 был построен на базе Ford Model B, и без американской модели выпуск советской машины стал бы невозможен. Тем не менее, нельзя говорить о том, что два автомобиля были близнецами.


Из-за более строгих требований некоторые узлы Ford Model B были переработаны или спроектированы заново. К тому же конструкторы Нижегородского автомобильного завода уже накопили солидный опыт в производстве и ремонте ГАЗ-А, так что к середине 30-х они уже знали, какие элементы требуют доработки.

В итоге по некоторым параметрам ГАЗ М-1 для своего времени был даже более передовым автомобилем, чем Ford Model B, как бы невероятно это ни звучало. К примеру, подвеска советской модели была построена на базе четырех продольных рессор вместо двух поперечных. Также «Эмка» получила поршневые гидравлические рычажные амортизаторы одностороннего действия, хотя заокеанский прототип использовал ротативные амортизаторы.

Еще одним нововведением стали резиновые подушки двигателя, которые позволили существенно снизить уровень вибрации и шума: на Ford Model B силовой агрегат устанавливался жестко. А вместо спицованных колесных дисков в СССР было решено остановиться на штампованных. При взгляде из XXI века совершенно очевидно, что по этим моментам ГАЗ М-1 оказался более современным автомобилем (шутка ли, эти решения до сих пор широко применяются в автомобилестроении).

Жизнь на конвейере

Первые серийные экземпляры «Эмки» сошли с конвейера 16 марта 1936 года. В общей сложности в том году было выпущено 2 524 автомобиля. Впоследствии объем производства был увеличен: в период до 11 декабря 1938 года предприятие собрало 41 650 легковушек.


Если верить документам ГАЗа, к 1942 году был произведено 62 888 экземпляров «Эмки». В июне 1943 кузовной цех завода был разрушен в результате налета немецкой авиации. После этого на свет появлялись лишь штучные автомобили, собранные из остатков запчастей. После окончания Великой Отечественной на базе М-1 производились отдельные модификации, ни одна из которых не стала поистине массовой. А уже в 1946-м на конвейер встал совершенно новый автомобиль — ГАЗ М-20 «Победа».

Технические характеристики ГАЗ М-1 (1936 год)

  • Длина: 4 625 мм;
  • ширина: 1 770 мм;
  • высота: 1 780 мм;
  • просвет под задним мостом: 210 мм;
  • колесная база: 2 845 мм;
  • масса: 1 370 кг;
  • грузоподъемность: 500 кг;
  • двигатель: бензиновый четырхцилиндровый нижнеклапанный, мощностью 50 лошадиных сил;
  • коробка передач: механическая, трехскоростная двуходовая;
  • максимальная скорость: 105 км/ч;
  • объем топливного бака: 60 литров;
  • расход топлива (по эксплуатационной норме): 14,5 л/100 км;
  • запас хода с полной нагрузкой по шоссе: 460 км.
  • пассажировместимость: пять человек.

статьи, истории создания и фотоматериалы ВАЗ, ГАЗ, АЗЛК (МЗМА)

История создания

ГАЗ М-1 – советский легковой автомобиль, выпускавшийся с 1936 по 1943 год. К середине 1930-х годов стало ясно, что ГАЗ А стремительно устаревает, поэтому было принято решение о разработке новой модели. Она получила название «ГАЗ М-1». Буква «М» расшифровывалась как «Молотов». В.М. Молотов был в то время главой правительства СССР. В народе прижилось название попроще — «Эмка».
ГАЗ М1 начали разрабатывать в 1933 году. По действующему соглашению, компания Форд предоставила заводу все документы на свой новый автомобиль — «Форд 40». Именно он послужил базовой моделью для нового автомобиля ГАЗ. Однако нельзя назвать «Эмку» полной копией американской машины. Многие узлы автомобиля были переработаны. Так, подвески были расположены на продольных, а не на поперечных рессорах. Изменения коснулись рулевого механизма и тормозов. В процессе производства автомобиль неоднократно модернизировался.
Хотя ГАЗ М-1 и не поступал в свободную продажу, он стал самым массовым автомобилем в довоенной стране. Он получил репутацию надежного и неприхотливого автомобиля.

Дизайн

Модель имела цельнометаллический закрытый кузов с брезентовой крышей. Элементы кузова штамповались и соединялись сваркой. В целом автомобиль имел минимальные внешние изменения от своего прототипа «Форд 40». Самой главной деталью стали новые, более широкие передние крылья.

Двигатель

Модель получила улучшенный двигатель от модели «ГАЗ А». Мощность возросла до 50 л.с. за счет изменения фаз газораспределения. Мотор также получил циркуляционную систему охлаждения и усовершенствованный карбюратор.

Модификации

ГАЗ-М-1 такси — модификация для таксопарков
ГАЗ-М-415 — модификация пикап
ГАЗ-11-73 — модернизированная версия ГАЗ М-1, с 6 цилиндровым двигателем и иной облицовкой передней части
ГАЗ-61-73 — модификация с полным приводом
БА-20 — бронеавтомобиль на узлах ГАЗ М-1

Технические характеристики автомобилей ГАЗ / GAZ

История марки ГАЗ

31 мая 1929 г. ВСНХ СССР и американская фирма «Ford Motor Company» заключили соглашение о технической помощи при организации и налаживании массового производства легковых автомобилей типа «Ford-А» и грузовых автомобилей типа «Ford-АА». Технологическое и строительное проектирование велось в Америке в основном силами отечественных инженеров при тесном сотрудничестве с фирмой «Ford Motor Company». Архитектурно-строительный проект разрабатывался фирмой «Austin and K».

29 января 1932 г. с конвейера сошел первый автомобиль — грузовик НАЗ-АА. А с декабря 1932 г. на автозаводе началась сборка легкового автомобиля среднего класса ГАЗ-А.

Первые автомобили моделей ГАЗ-А и ГАЗ-АА изготавливались по чертежам американской фирмы «Форд». Несмотря на это. они уже несколько отличались от американских прототипов: для российского варианта были усилены картер сцепления и рулевой механизм. Сочетая использование фордовских разработок с поиском и внедрением своих решений. конструкторы создали немало модификаций на базе «полуторки». В 1933 г. появился автобус служебного назначения ГАЗ-03-30.В конце 1934 г. на конвейер встал трехосный грузовик ГАЗ-ААА. Позже появился самосвал ГАЗ-410. А в 1937 г. на филиале Горьковского автомобильного завода начался выпуск санитарного автобуса ГАЗ-55. Также в те годы был создан и газогенераторный грузовик ГАЗ-42. На базе автомобиля ГАЗ-А был создан пикап ГАЗ-4 с цельнометаллической кабиной и металлической платформой на 500 кг груза. Пикапы ГАЗ-4 стали сходить с конвейера в 1933 г.

Новой вехой в истории завода стало создание и освоение легкового автомобиля М-1. По соглашению. подписанному с фирмой «Форд». этому автомобилю. как и ГАЗ-А. был также определен свой фордовский прототип. Однако конструкторский коллектив ГАЗа. возглавленный в 1933 г. талантливым специалистом и организатором А.А.Липгартом. учитывая не только полученный опыт производства и эксплуатации первой модели. но и свою собственную точку зрения на отечественный автомобиль. решительно отказался от копирования американского образца.

Внешний вид автомобиля тоже был изменен: за счет укрупнения передней части и удлиннения рамы и колесной базы лучше стали пропорции. более интересным стал облик всего переднего узла — крыльев капота и облицовки радиатора. Таким образом. конструкторский коллектив завода созданием автомобиля ГАЗ-М1 не только выдержал крупный экзамен. но и заложил основы конструкторской школы ГАЗа. В 1937 г. автомобиль М-1 достойно представил СССР на Всемирной промышленной выставке в Париже.

Легковой автомобиль с новым двигателем получил индекс ГАЗ-11-73. Его первые образцы были готовы в 1938 году. Кроме силовой установки. на автомобилях был введен еще целый ряд усовершенствований: удлиненные передние рессоры. более эффективные тормоза. новый щиток приборов и др. На базе ГАЗ-11-73 был создан автомобиль ГАЗ-11-40 с кузовом фаэтон. начать серийное производство которого помешала война. А вот полноприводная модификация ГАЗ-61. созданная В.А. Грачевым. выпускалась серийно. Автомобиль мог преодолевать подъемы крутизной 38`. без труда поднимался по крутой пешеходной лестнице. преодолевал брод глубиной 720 мм. Специалисты утверждали. что при установке специальных шин с развитыми грунтозацепами ГАЗ-61 по проходимости превосходил полугусеничные машины.

Великая Отечественная война потребовала переориентации завода на выпуск боевой техники.Заводские конструкторы и технологи оперативно разработали и подготовили к производству новые машины: вездеходы ГАЗ-64 и ГАЗ-67. бронеавтомобили БА-64. БА-64Б. танки: Т-60. Т-70. Наряду с грузовыми автомобилями завод развернул выпуск самоходных орудий. боеприпасов и различного военного снаряжения.

Правительство высоко оценило труд автозаводцев в годы войны. наградив завод орденами Ленина. Красного Знамени и Отечественной войны I степени. Первым в ряду новинок стоял грузовик ГАЗ-51. Их массовый выпуск начался в июне 1946 г.

ГАЗ-51 для того времени представлял собой весьма передовую и совершенную конструкцию. Его создатели при небольшом увеличении массы по сравнению с предшественником сумели повысить грузоподъемность более чем в полтора раза и межремонтный пробег в два раза. Усиленная рама и узлы ходовой части обладали немалым запасом прочности и могли эксплуатироваться с большими перегрузками. Шестицилиндровый двигатель мощностью 70 л.с. позволял развивать скорость 70 км/час. За три десятка лет автомобиль неоднократно модернизировали. Первоначально на машинах. в связи с острым дефицитом стального листа в послевоенные годы. стояла кабина смешанной деревянно-металлической конструкции с деревянными подножками. Позже кабины стали цельнометаллическими. В последующие годы автомобиль претерпел еще целый ряд изменений. которые нашли отражение в индексе модели — ГАЗ-51А.

Вторым был освоен автомобиль ГАЗ М-20. знаменитая «Победа». Первая партия была собрана в июне 1946 г. Этому автомобилю суждено было стать не просто этапным. а вписать яркую страницу в историю не только отечественного. но и мирового автомобилестроения. ГАЗ М-20 стал знаменит прежде всего благодаря оригинальной форме кузова. который создавал очень малое аэродинамическое сопротивление. всего 0.34. Дизайн машины открывал новую тенденцию в тогдашней автомобильной моде. подхваченной в последующие 2-3 года многими мировыми автопроизводителями. «Победа» стала первым советским автомобилем с несущим кузовом и первым в мире серийным автомобилем с кузовом «бескрылой» формы. Машину также отличали независимая подвеска передних колес. гидравлический привод тормозов. навеска дверей на передних петлях. V-образное лобовое стекло. В комфортабельном салоне с отопителем свободно размещались 5 человек. Стоит отметить. что для обеспечения дополнительного комфорта все «Победы» комплектовали радиоприемниками.

Наряду с базовой моделью с кузовом седан с 1949 года выпускалась модификация с кузовом кабриолет. В соответствии с развитием в стране таксомоторного сообщения. было изготовлено более 37 тысяч автомобилей модификации «такси». Всего же за двенадцать с половиной лет с конвейера сошло более 235 тысяч автомобилей ГАЗ М-20. На его базе выпускалась и полноприводная модель ГАЗ-72.

В 1948 году коллектив конструкторов во главе с А.А. Липгартом и Н.А. Юшмановым по правительственному заданию начал проектирование нового легкового автомобиля большого класса. получившего индекс ГАЗ-12 «ЗИМ»(Завод имени Молотова). Первая промышленная партия была выпущена уже в 1950 году.

Автомобиль обладал рядом прогрессивных для того времени технических решений и отличался высоким уровнем комфорта: обогрев задних сидений. трехдиапазонный радиоприемник. переключатель указателей поворота с автоматическим сбросом. Автомобиль с форсированным двигателем ГАЗ-51 был самым мощным (95л.с.) и самым скоростным (до 125 км/час) в модельном ряду. Помимо ГАЗ-12 с закрытым шестиместным кузовом типа седан разработана модификация с кузовом кабриолет. а также машина «скорой помощи» ГАЗ-12Б. которая выпускалась серийно.

«Волга» ГАЗ-21. вставшая на конвейер в конце 1956 года. является особым. классическим автомобилем. Для множества людей «двадцать первая» стала символом целой эпохи. Передовая для своего времени. она и сейчас имеет немало поклонников. В последние годы наблюдается даже определенное повышение интереса к этой модели. Модные «хот-роды» на базе «двадцать первой». да и конвейерные машины попадаются на глаза на улицах. лишний раз подтверждая. что «Волга» относится к числу самых прочных и долговечных автомобилей. К слову. она прекрасно вела себя в роли «такси».

В 1959 году настало время и для нового флагмана предприятия. Им стала семиместная «Чайка» ГАЗ-13. Дизайн машины навеян образцами американских производителей. тогдашних законодателей автомобильной моды. А в отношении конструкции «Чайка» представляла несомненный интерес благодаря целому ряду технических новшеств. Она оснащалась V-образным восьмицилиндровым двигателем мощностью 195 л.с.. четырехкамерным карбюратором. гидроусилителем руля. гидромеханической коробкой передач. Управление переключением передач было кнопочным. а антенна радиоприемника выдвигалась автоматически. Оборудование кузова включало: электрические стеклоподъемники. омыватель ветрового стекла. всеволновый радиоприемник с автоматической настройкой. противотуманные фары и др. Наряду с базовой моделью. имевшей кузов седан. небольшими партиями выпускались лимузины ГАЗ-13А и кабриолеты ГАЗ-13Б.

В эти же годы велась разработка автомобиля «Волга» ГАЗ-24. который был запущен в массовое производство в 1970 году. Новую «Волгу» характеризовали улучшенные динамические качества. более просторный и комфортабельный салон. вместительный багажник. безопасность конструкции и удобство управления. «Двадцать четвертая» отличалась строгостью форм. простотой. величием и всегда была воплощением качества. достоинства и престижа. Высокая прочность кузова и ходовой части ГАЗ-24 сделала этот автомобиль незаменимым для работы в качестве «такси». С 98-сильным двигателем ГАЗ-24 развивал скорость до 140 км/час. разгонялся с места до 100 км/час за 23 секунды (против 34 секунд у ГАЗ-21).

Конец 1970-х годов был отмечен выпуском третьего поколения легковых автомобилей большого класса. «Чайка» ГАЗ-14 создавалась под руководством А.Д. Просвирнина при участии Н.А. Юшманова. В.Н. Носакова. С.В. Волкова. Ю.И. Докукина и многих других конструкторов. Красивый семиместный представительский автомобиль славился высоким техническим уровнем и комфортабельностью американских шоссейных «дредноутов». На ГАЗ-14 ставился V-образный 8-ми цилиндровый 220-сильный двигатель. позволявший развивать скорость до 175 км/час. Среди лимузинов (в салоне некоторых ГАЗ-14 ставилась перегородка) горьковский автомобиль был наиболее легким и компактным. Располагая еще целым рядом новшеств. «Чайка» ГАЗ-14 явилась настоящим полигоном для внедрения новых конструкций. материалов и технологий для последующих моделей ГАЗ массового производства.

В 1984 году начался выпуск модели «Волги» ГАЗ-3102. От предшественницы она отличалась новым решением передней и задней части. что придавало автомобилю большую солидность. Новым было оформление интерьера и приборной панели. На «тридцать первую» устанавливали более удобные сиденья с подголовниками. Система тормозов также была усовершенствована. Интересно. что на первых партиях автомобилей ГАЗ-3102 устанавливался двигатель с форкамерно-факельным зажиганием. По причине своей исключительности несколько лет «тридцать первая» использовалась только государственными и партийными структурами в качестве служебного автомобиля.

(В статье использованы официальные материалы музея ГАЗ)

ГАЗ-М1 купе — Русская техника

Спортивный автомобиль ГАЗ-М1 купе

ГАЗ-М1 купе 

Легендарный автомобиль ГАЗ-М1 «Купе» был создан инженерами Горьковского автомобильного завода им. Молотова в 1937 году. На ГАЗе «эмку» решили использовать в гонках, над этим проектом работала команда инженеров, специализирующаяся на создании спортивных автомобилей. Внешне передняя часть прототипа позаимствована у серийной 4-х дверной модели «эмки», а вот все остальные детали кузова у двухместного серийного Ford Model 40 DeLuxe V8 Coupe 1933 . В Штатах эта машина предназначалась для состоятельных коммивояжеров и элитной молодежи.

На ГАЗ-М1 купе был установлен восьмицилиндровый нижнеклапанный мотор Ford V8 объемом 3,6 л и мощностью 65 л.с. в паре с 3-х ступенчатой коробкой передач (три скорости вперёд и одна – назад), которая получила существенные изменения: были добавлены шестерни постоянного зацепления на второй ступени и скользящаая зубчатая муфта включения второй и третьей передачи. Электропитание функционировало посредством аккумулятора напряжением в 6 вольт. Бак был расположенный в заднем свесе рамы, а для подачи топлива служил бензонасос.

Рама на ГАЗ-М1 купе позаимствована у ГАЗ-М1, усиленная Х-образная стальная штампованная рама, спереди у «эмки» кованая балка, сечение лонжеронов и траверсной рамы увеличено. Передача крутящего момента осуществлялось посредством однодискового, сухого сцепления на коробку передач через карданный вал, который монтировался в жестко закрепленную железную трубу, на неразрезной мост с конической передачей. Подвеска на четырех продольных полуэллиптических рессорах. Диски в данной модели металлические штампованные с шинами размером 7.00-16. Тормоза колодочного типа спереди и сзади с механическим приводом. Автомобиль получил новое, более усовершенствованное рулевое управление. 

На раму крепится закрытый двухдверный цельнометаллический кузов. Доступ к мотору осуществлялся через открывающиеся боковины с обеих сторон автомобиля. Двери подвешивались на петлях и открывались навстречу движению машины, также имели опускающееся стекло для проветривания салона. Для вождения в непогоду в автомобили имелся один дворник, который располагался на верхней рамке лобового стекла перед лицом водителя. Стеклоочиститель функционировал посредством вакуумного привода. Автомобиль имел два запасных колеса в нишах передних крыльев и одно, размещенное на задней стенке кузова в декоративном металлическом кожухе. Вождение в ночное время облегчали четыре электрических фары головного света, на крыльях авто располагались габаритные огни, сзади машины также устанавливались габариты и стоп-сигналы.

вид сбоку ГАЗ-М1 купе 

Интерьер ГАЗ-М1 купе в меру скромный, сиденья и потолок обтянут светло-коричневым или серым шерстяным сукном, а рамки окон и торпедо окрашивались под дерево ценной пароды. На панели приборов перед водителем слева находился спидометр, а справа — информационные приборы: уровень топлива, манометр информирующий о давлении масла в поддоне и амперметр. Головной свет включался ножной гашеткой. Также на панели перед пассажиром имелся бардачок для хранения мелких вещей. Для комфорта вождения в солнечный день предусмотрены солнцезащитные козырьки. Для курильщиков в салоне имелся прикуриватель и пепельница. Для комфортного расположения на водительском месте предусмотрена регулировка сидения, которое могло регулироваться только в двух направлениях вперед и назад, спинка сидения не регулировалась.

Технические характеристики ГАЗ-М1 с кузовом «купе»:

  • длина – около 5000 мм;
  • ширина – 1750 мм;
  • высота – 1750 мм;
  • колесная база – 2845 мм;
  • снаряженная масса – н/д;
  • вместимость – 2 чел.

В августе 1937 года ГАЗ-М1 «купе» участвовал на скоростных соревнованиях протяженностью в 100 километров. Против «эмки» выступали перспективные ГАЗ-11-40 с шестицилиндровыми двигателями ГАЗ-11 и иностранные легковые автомобили . Купе на базе ГАЗ-М1 в этих заездах обошло абсолютно всех конкурентов, заняв первое место. При этом ГАЗ-11-40 занял второе место, уступив всего пять секунд победителю.

ГАЗ-М1 с кузовом купе так и осталась экспериментальным двухместным спортивным концептом с большой перспективой, которую задавила Вторая мировая война. Производство Горьковского автомобильного завода сосредоточилось на производстве пикапов, легковых автомобилей повышенной проходимости и тягачей.

вид сзади ГАЗ-М1 купе 

M1 Abrams Main Battle Tank

M1 Abrams Main Battle Tank — Технические характеристики


Основной боевой танк M1 Abrams

Технические характеристики
M1 / ​​IPM1 M1A1 M1A2
Производитель General Dynamics (Land Systems Division)
Экипаж 4: Командир, наводчик, заряжающий и водитель
Масса 60 тонн 63 тонны 69.54 тонны
Длина (орудие вперед) 384,5 дюйма 387 дюймов
Высота башни 93,5 дюйма
Ширина 143,8 дюйма 144 дюйма
Дорожный просвет 19 дюймов
Давление на грунт 13,1 PSI 13,8 PSI 15,4 PSI
Пересечение препятствий 49 дюймов 42 дюйма
Вертикальная траншея 9 футов
Электростанция Газотурбинный двигатель АГТ-1500
Номинальная мощность 1500 л.с.
Отношение мощности к массе 25 л.с. / т 23.8 л.с. / тонна 21,6 л.с. / тонна
Гидрокинетическая трансмиссия 4 скорости вперед
2 скорости назад
Скорость — максимальная 45 миль в час (регулируемая) 42 миль в час (регулируемая)
Скорость — по пересеченной местности 30 миль / ч
Скорость — 10% уклон 20 миль / ч 17 миль / ч
Скорость — 60% уклон 4,5 миль / ч 4,1 миль / ч
Ускорение
(От 0 до 20 миль / ч)
7 секунд 7.2 секунды
Запас топлива 498 галлонов (1885 литров) / 505 галлонов (1907 литров)
Запас хода 275 миль 265 миль
Расход топлива В баке потребуется примерно 300 галлонов каждые восемь часов; это будет зависеть от миссии, местности и погоды. Для дозаправки одного бака требуется 10 минут. Заправка и перевооружение танкового взвода — четырех танков — в идеальных условиях занимает примерно 30 минут.
  • 0,6 мили на галлон.
  • 60 галлонов в час при поездках по пересеченной местности
  • 30+ галлонов в час при работе в тактическом идеале
  • 10 галлонов, основной режим простоя
  • Шахтный плуг увеличит расход топлива танка на 25 процентов
  • Основное вооружение 105-мм M68A1
    Нарезная пушка
    120-мм M256
    Гладкоствольная пушка
    Оружие командира.Пулемет M2 50 Cal
    Спаренное оружие Пулемет M240 7,62
    Оружие заряжающего Пулемет M240 7,62 на коньковой установке
    Базовая нагрузка Орудие 40 снарядов (M1A2 42 снаряда)
    Командирский пулемет 50 калибра 1000 патронов
    M240 7,62 MG (COAX) / Зарядный пулемет M240 MG 10800 выстрелов
    Дымовые гранаты 24 выстрела
    Система NBC 200 SCFM — CleanCooled Air
    Инвентарь армии США 4393 586 M1A2
    588 M1A2 SEP
    Инвентарь USMC 403
    Запасы Прочие 777 Египет 315 Саудовская Аравия
    218 Кувейт
    Стоимость замены единицы 4 300 000 долл. США

    НОВОСТИ ПИСЬМО

    Присоединяйтесь к GlobalSecurity.список рассылки org


    Не продавайте мою личную информацию

    Последнее изменение страницы: 16-01-2013 23:29:52 ЗУЛУ

    M1 Abrams Основной боевой танк

    Основной боевой танк (ОБТ) M1 Abrams является тезкой покойного генерала Крейтон В.Абрамс, бывший начальник штаба армии и командующий 37-й дивизией. Бронетанковый батальон. Это костяк бронетанковых войск США, а также некоторых их союзников. Эта машина предназначена для обеспечения мобильной огневой мощи бронетанковых формирований, достаточной для успешного сближения и уничтожения любой противостоящей боевой бронированной машины в мире, обеспечивая при этом защиту ее экипажа в любой мыслимой боевой обстановке. Он способен поражать врага в любую погоду, днем ​​и ночью на многомерном нелинейном поле боя, используя свою огневую мощь, маневренность и ударный эффект.Система танков Abrams синхронизирует свой высокий темп, распределенное маневрирование за счет цифровой ситуационной осведомленности и сочетания бортовых и удаленных датчиков поля боя.

    Завершено производство танков M1A1 для армии США. Свыше 8 800 танков M1 и M1A1 было произведено для армии и морской пехоты США, а также для армий Египта, Саудовской Аравии и Кувейта. Производство новых танков M1A1 и M1A2 Abrams находится на завершающей стадии для продажи за рубежом. В настоящее время на вооружении стоят три версии танка Abrams: исходная модель M1, датируемая началом 1980-х годов, и две более новые версии, получившие обозначения M1A1 и M1A2.Серия M1A1, выпускавшаяся с 1985 по 1993 годы, заменила 105-мм пушку M1s 120-мм пушкой и включала множество других усовершенствований, включая улучшенную подвеску, новую башню, усиленную броневую защиту и систему ядерно-химико-биологической защиты. Более новая серия M1A2 включает в себя все функции M1A1, а также независимый тепловизор для командира, независимый командирский боевой модуль, оборудование для позиционной навигации, а также шину цифровых данных и блок радиоинтерфейса, обеспечивающий общую картину для M1A2 на поле боя.

    Вместо нового производства армия модернизирует около 1000 старых танков M1 до конфигурации M1A2. Армия также инициировала программу модификации M1A2, чтобы улучшить его возможности цифрового управления и контроля и добавить дальний инфракрасный прицел второго поколения (FLIR), чтобы улучшить боеспособность и летальность танка в условиях ограниченной видимости. Эта программа усовершенствования системы будет запущена в период 2000 года одновременно с M2A3 Bradley и другими передовыми цифровыми системами.Первоначальный M1A2, направленный в дивизию First Calvary Division, Ft. Худ, Техас, продолжается. Армия продолжит направлять M1A2 в резервный корпус CONUS и другие первые боевые единицы в следующем десятилетии.

    M1 / ​​IPM1 M1A1 M1A2
    Длина: 32.04 FT 32,25 футов 32,25 футов
    Ширина: 12.0 футов 12.0 футов 12.0 футов
    Высота: 7,79 футов 8.0 футов 8,0 футов
    Максимальная скорость: 45.0 МИЛЬ / Ч 41,5 миль / ч 41,5 миль / ч
    Вес: 60 ТОНН 67,6 ТОНН 68.7 ТОНН
    Вооружение: 105 мм 120 мм 120 мм
    Экипаж: 4 4 4

    Танк серии M1 оснащен газотурбинным двигателем Lycoming Textron мощностью 1500 лошадиных сил, соединенным с гидрокенетической трансмиссией Allison с четырьмя передними и двумя задними передачами.Его тактическая дальность поражения составляет примерно 275 миль. Несмотря на свой вес, M1 может развивать максимальную скорость почти 45 миль в час. Основное вооружение — 120-мм гладкоствольная пушка, пришедшая на замену 105-мм пушке в первоначальной версии M1. У него есть возможность вести дневной / ночной огонь на ходу, что обеспечивается лазерным дальномером, тепловизионным ночным прицелом, оптическим дневным прицелом и цифровым баллистическим вычислителем. И топливо, и боеприпасы разделены на отсеки для повышения живучести. Корпус и башня защищены усовершенствованной броней, аналогичной броне Chobam, разработанной Министерством обороны Великобритании.При необходимости «Абрамс» может быть оснащен «реактивной броней» для защиты от бронебойных боеприпасов.

    Несмотря на то, что «Абрамс» был выпущен на вооружение в 1980 году, он оставался непроверенным более 10 лет. Когда Ирак вторгся в Кувейт в августе 1990 года, были опасения, что «Абрамс» станет жертвой песка и долгих месяцев непрерывной эксплуатации без роскоши ремонтных сооружений мирного времени. Были также сомнения в боевой живучести разветвленной электроники башни.Сразу после решения президента Буша направить силы США в регион Персидского залива для защиты Кувейта и Саудовской Аравии, американские бронетанковые подразделения начали сложный процесс перебазирования в угрожаемый район. Из-за небольшого размера и веса Abrams C-5 Galaxy, самый большой грузовой самолет в составе ВВС США, мог одновременно обслуживать только один танк. Это означало, что почти все танки Abrams, развернутые в войне в Персидском заливе, были доставлены грузовыми судами. Хотя прибытие «Абрамса» было медленным, союзные войска приветствовали его прибытие, поскольку он способен победить любой танк, имеющийся на вооружении Ирака.

    Иракская армия располагала значительным количеством танков, в основном закупленных в бывшем Советском Союзе. Главным среди них было около 500 Т-72. Эти современные советские танки были вооружены прекрасным 125-мм гладкоствольным орудием и имели многие из тех же передовых функций, что и Абрамс. Несмотря на передовую конструкцию, Т-72 оказался хуже, чем M1A1, развернутый во время войны в Персидском заливе, и более близко сравнивался со старыми танками M60A3, использовавшимися там Корпусом морской пехоты США. Кроме того, в Ираке имелся ряд более ранних советских моделей: около 1600 Т-62 и около 700 Т-54, оба из которых были разработаны в 1960-х годах.Многие считали, что эти танки явно уступают Abrams, но должны были обладать высокой механической надежностью. Война в Персидском заливе дала военным тактикам возможность оценить разработки в конструкции танков, которых не было со времен Второй мировой войны.

    В своей книге «Победа в пустыне — Война за Кувейт» автор Норман Фридман пишет, что «Армия США в Саудовской Аравии, вероятно, имела около 1900 танков M1A1. Ее способность надежно вести огонь при движении на скорости по пересеченной местности (из-за того, что стабилизированная артиллерийская установка) дала ему возможность, которая оказалась полезной в Персидском заливе.У танка Abrams также есть приборы видения, которые доказали свою эффективность не только ночью, но и в пыли и дыме Кувейта днем. В среднем Abrams превосходил иракский танк примерно на 1000 метров «. Фактическое количество танков Abrams M1 и M1A1, задействованных в войне в Персидском заливе (согласно официальным источникам Министерства обороны США), следующее: Всего 1848 M1A1 и M1A1″ Heavy Armor » «(или HA) танки были развернуты между армией США и морской пехотой (которая выставила на вооружение 16 M1A1 и 60 M1A1 (HA) танков).

    По мере того, как война в Персидском заливе сместилась с операции «Щит в пустыне» на операцию «Буря в пустыне», а подготовительные бомбардировки прекратились, У.Танки S. Abrams возглавляли атаку иракских укреплений и, когда и где это было возможно, вступали в бой с танками противника. Так же, как в Иране-Ираке Во время войны иракская армия использовала свои танки в качестве стационарных противотанковых и артиллерийских орудий, закапывая их в землю, чтобы уменьшить заметность цели. Однако это также помешало их быстрому передвижению, и авиация союзников сокрушила почти 50% танковой угрозы Ирака до того, как бронетехника союзников пересекла границу. После этого танки «Абрамс» быстро уничтожили ряд иракских танков, которые успели стать мобильными.

    Тепловизионный прицел «Абрамса» не скрывал густых облаков. черный дым над полем боя, возникший в результате горящих кувейтских нефтяных скважин. На самом деле многие канониры полагались на свои «ночные» прицелы при дневном свете. Иначе обстоит дело с прицелами на иракских танках, которые поражались частями, которых они даже не видели. Опасения по поводу дальности действия M1A1 были устранены в результате масштабной операции по пополнению запасов, которая будет изучаться в течение многих лет как образец тактической эффективности.

    Во время войны в Персидском заливе только 18 танков Abrams были выведены из эксплуатации из-за боевых повреждений: девять были безвозвратными потерями, а еще девять получили восстановимые повреждения, в основном из-за мин. Ни один член экипажа «Абрамса» не погиб в ходе конфликта. Сообщений о механических неисправностях было немного. Командиры бронетехники США поддерживали беспрецедентную оперативную готовность своих основных боевых танков Abrams на уровне 90%.

    См. Также : Система лезвий для разминирования M1. 403 USMC
    M1 / ​​IPM1 M1A1 M1A2
    Производитель General Dynamics (подразделение Land Systems)
    Экипаж 4: Командир, наводчик, заряжающий и водитель
    Масса 60 тонн 63 тонны 69,54 тонны
    Длина (орудие вперед) 384.5 дюймов 387 дюймов
    Высота башни 93,5 дюйма
    Ширина 143,8 дюйма 144 дюйма
    Дорожный просвет 19 дюймов
    Давление на грунт 13,1 PSI 13,8 PSI 15,4 PSI
    Пересечение препятствий 49 дюймов 42 дюйма
    Вертикальная траншея 9 футов
    Силовая установка Турбинный двигатель AGT-1500
    Номинальная мощность 1500 л.с.
    Отношение мощности к массе 25 л.с. / т 23.8 л.с. / тонна 21,6 л.с. / тонна
    Гидрокинетическая трансмиссия 4 скорости вперед
    2 скорости назад
    Скорость — максимальная 45 миль в час (регулируемая) 42 миль в час (регулируемая)
    Скорость — по пересеченной местности 30 миль / ч
    Скорость — 10% уклон 20 миль / ч 17 миль / ч
    Скорость — 60% уклон 4,5 миль / ч 4,1 миль / ч
    Ускорение
    (От 0 до 20 миль / ч)
    7 секунд 7.2 секунды
    Дальность плавания 275 миль 265 миль
    Основное вооружение 105-мм M68A1
    Нарезная пушка
    120-мм M256
    Гладкоствольная пушка
    M1933 ​​Оружие командира Пулемет
    Спаренное оружие Пулемет M240 7,62
    Оружие заряжающего Пулемет M240 7,62 на коньковой опоре
    Система NBC 200 SCFM — CleanCooled Air
    Инвентарь
    Стоимость замены единицы 4 300 000 долл. США

    M1 / ​​IPM1 Abrams Основной боевой танк


    Разработан в 1970-х годах отделом наземных систем компании General Dynamics. Corporation в ответ на сообщение U.Программа MBT-70 компании S. Army, первый M1 сошел с конвейера в 1978 году. После двух лет приемочных испытаний первая из этих машин была доставлена ​​в армию США 28 февраля 1980 года. К 1985 году оценки полевой службы вызвали первые запросы на модификацию, и производство перешло на M1A1. Первые M1A1 были доставлены в части в августе 1985 года. Армия переоборудовала 368 старых M1 до M1A2. Еще 580 M1 модернизируются до A2 в соответствии с пятилетним контрактом, заключенным в 1996 финансовом году, при этом запланировано 998 обновлений M1.В 1999 году армия начала модернизацию M1 до конфигурации M1A2 System Enhancement Program (SEP). SEP встраивает возможности оцифровки в электронную архитектуру Abrams, устраняя необходимость в электронных приложениях.

    M1A1 Abrams Основной боевой танк

    M1A1 — улучшенная версия M1 Main Battle Tank (MBT). Он включает в себя 120-мм гладкоствольную главную пушку, систему защиты от избыточного давления NBC и улучшенный пакет брони.Этот танк значительно увеличивает возможности морской пехоты флота по всему спектру конфликтов в ближайшей и среднесрочной перспективе. Танк M1A1, помимо улучшенной брони, 120-мм гладкоствольной пушки и системы избыточного давления NBC, имеет комплект глубоководного фординга (DWFK), систему определения местоположения (PLRS), улучшенную привязку кораблей, цифровой электронный блок управления (DECU). (что позволяет значительно экономить топливо) и Battlefield Override.

    Основным оружием M1A1 является 120-мм гладкоствольная пушка M256, разработанная немецкой корпорацией Rheinmetall.Дальность поражения, приближающаяся к 4000 метров, была успешно продемонстрирована во время операции «Буря в пустыне». Основным бронебойным боеприпасом этого оружия является бронебойный подкалиберный снаряд со стабилизированным плавником (APDS-FS) с проникающими элементами из обедненного урана. Обедненный уран имеет в два с половиной раза большую плотность, чем сталь, и обеспечивает высокие проникающие свойства. Также доступны несколько других типов боеприпасов. Он надежен, смертельно точен и имеет «соотношение попаданий / убийств», которое равно или превосходит любое вооружение основных боевых танков в мире.

    Как и практически каждый танк, каждый из которых стоит на вооружении США, знакомый пулемет Browning M2 Heavy Barrel калибра .50 — «Ma Duce» — расположен в механизированной установке на посту командира и оснащен прицелом с увеличением x3. Погрузчик имеет калибр 7,62 мм. Пулемет M240, а еще один M240 установлен на одной линии с основным орудием танка («соосно»). Он находится в стационарной установке и нацелен из основного орудия на подавление наземных войск противника. Компоновка Abrams соответствует классической конструкции танка и вмещает экипаж из четырех человек: командир, наводчик, заряжающий и водитель.Командир и наводчик сидят с правой стороны башни. Погрузчик расположен с левой стороны башни, а водитель — по центру передней части корпуса. Станция командира оборудована шестью перископами, обеспечивающими круговой обзор на 360 градусов. Независимый тепловизор (ITV) от Texas Instruments обеспечивает ему независимое, стабилизированное дневное и ночное видение с обзором на 360 градусов, автоматическое сканирование секторов, автоматическое наведение на цель для прицела наводчика без необходимости устного общения и полное резервное копирование. Система управления огнем — командир может вести огонь из основного орудия независимо от наводчика.Первичная линия визирования (GPS-LOS) для наводчика была разработана отделом электрооптических систем компании Hughes Aircraft Company. Тепловизионная система ночного видения (TIS), также от Hughes, создает изображение на основе различий в тепле, излучаемом объектами в поле зрения. Тепловизионное изображение отображается в окуляре прицела наводчика вместе с измерением дальности с точностью до 10 метров от лазерного дальномера Hughes, интегрированного во все системы управления огнем.На Abrams также есть бортовой цифровой компьютер управления огнем. Данные о дальности от лазерного дальномера передаются непосредственно в компьютер управления огнем, который автоматически рассчитывает решение для управления огнем. Данные включают: 1) измерение угла упреждения, 2) изгиб пушки, измеренный дульной системой отсчета основного вооружения, 3) измерение скорости ветра от датчика ветра на крыше башни и 4) данные с маятниковый датчик статического перекоса, расположенный в центре крыши башни.Стрелок или командир вручную вводит данные о типе боеприпасов и температуре, а также о барометрическом давлении, и оружие готово к стрельбе. Станция заряжания находится в левой части башни и не имеет специальной аппаратуры управления огнем. Станция Driver расположена в центральной передней части корпуса. Водитель находится в полулежавшем положении, когда его люк закрыт, как и должно быть, когда транспортное средство находится в движении.Его станция оснащена стандартным набором датчиков и мониторов, отражающих состояние уровня жидкости в автомобиле, аккумуляторов и электрического оборудования. Водитель имеет либо три перископа наблюдения, либо два перископа с каждой стороны и центральный перископ с усилением изображения («Звездный свет») для ночного видения. Перископы обеспечивают поле обзора 120 градусов. Оборудование ночного видения водителя позволяет танку маневрировать на обычных дневных скоростях движения в темноте и в условиях плохой видимости, например, в пыли и дыме на поле боя.Башня оснащена двумя шестиствольными дымовыми гранатометами M250, по одному с каждой стороны от основного орудия. Стандартная дымовая граната содержит люминофор, который маскирует тепловую сигнатуру машины для противника. Дымовая завеса также может быть установлена ​​системой с приводом от двигателя.

    В рамках программы усовершенствований все танки M1A1 в конечном итоге будут модернизированы со стальной броней из обедненного урана, плотность которой как минимум в два с половиной раза выше, чем у стали.Броня из обедненного урана увеличит общий вес танка Abrams до 65 тонн, но при этом обеспечит значительно улучшенную защиту.

    Хранение боеприпасов основного вооружения осуществляется в бронированных ящиках для боеприпасов за раздвижными броневыми дверями. Броневые переборки отделяют боевое отделение от топливных баков. Танк оборудован автоматической системой пожаротушения с использованием галона. Эта система автоматически активируется в течение 2 миллисекунд после вспышки или возгорания в различных отсеках автомобиля.Верхние панели бака предназначены для выстрела наружу в случае проникновения кумулятивного снаряда.

    Ядерная, биологическая и химическая защита (ЯБХ) обеспечивается системой кондиционирования воздуха с избыточным давлением, системой радиологического предупреждения и детектором химических агентов. Экипаж индивидуально экипирован защитными костюмами и масками.

    Корпус морской пехоты выставил на вооружение общий танк M1A1, чтобы заменить стареющий танк M60A1 Rise / Passive.Срок службы M60 подошел к концу, и у нее нет возможности выжить и противостоять угрозам, с которыми можно столкнуться на современном поле боя. Во время операции Desert Shield / Storm корпус морской пехоты позаимствовал у армии США 60 M1A1 (называемых M1A1 Heavy Armor). Также 16 танков M1A1 Корпуса морской пехоты были доставлены по ускоренному графику для использования во время операции. Всего 76 танков M1A1 использовались 2-м танковым батальоном и частями 4-го танкового батальона.Танки M1A1 незамедлительно подверглись атаке во время наступления I экспедиционного корпуса морской пехоты (IMEF) через горящие нефтяные месторождения Кувейта. Все заимствованные танки были возвращены армии США после «Бури в пустыне».

    Из-за уникальных требований корпуса морской пехоты к амфибии, а также необходимости обеспечения поддержки и взаимодействия между корпусом морской пехоты и армией США, две службы согласились совместно производить основной боевой танк M1A1. ОБТ M1A1 может проводить операции на берегу.Он совместим со всеми десантными кораблями и плавсредствами ВМС США (включая LCAC) и кораблями предварительного позиционирования (MPS). В течение 96 финансового года USMC завершила установку всех танков, в том числе активных, резервных, MPS и поплавков для технического обслуживания депо (DMF).

    В 1995 году 26-й MEU стал первым десантным подразделением, несущим M1A1. Это несколько усложнило логистику подразделения из-за веса танка. Автомобиль весом более 68 тонн требует особого ухода при проведении десантных операций.Один танк можно нести за раз на десантном корабле на воздушной подушке (LCAC), два — на десантном судне (LCU), но только во время относительно спокойного моря. Для действий в составе морской пехоты танки оснастили специальными системами преодоления брода. Эти модификации включают в себя удлиненные воздухозаборники и выхлопные трубы, которые позволяют транспортным средствам пересекать реки и мелководья, такие как зоны прибоя, в которых работают морпехи.

    Программа M1A1 Abrams Tank Firepower Enhancement Program (FEP) , инициатива системного командования морской пехоты, предназначена для увеличения дальности обнаружения и поражения целей в любую погоду, днем ​​и ночью, а также обеспечивает возможность дальнего обнаружения цели для танка M1A1.Система FEP будет включать в себя объем работ, который повлечет за собой набор обновлений для танка M1A1. Эти обновления включают в себя тепловизионный прицел второго поколения и возможность обнаружения севера / цели. Система повысит способность экипажа танка обнаруживать, распознавать, идентифицировать и точно определять местонахождение целей.

    M1A1D Abrams Основной боевой танк

    Флот M1A1 остается большей частью Armor Force. M1A1D — это оцифрованный M1A1, который обеспечивает улучшенную ситуационную осведомленность и возможность определения дальней цели.Установка цифрового пакета команд и управления на M1A1 необходима для достижения требуемых возможностей Force XXI. Еще одним запланированным усовершенствованием является замена аналогового сетевого блока турелей (TNB) и сетевого блока корпуса (HNB) новыми цифровыми блоками, чтобы устранить связанные с этим проблемы устаревания и позволить ввести возможность встроенного тестирования (BIT) для поддержки Force XXI структура обслуживания. Цифровые TNB и HNB также обеспечивают электронный рост в будущем, предоставляя незанятые слоты для карт VME.

    В области живучести армия работает над разработкой и внедрением пакета брони на случай непредвиденных обстоятельств, который будет тонким и легким, но с высоким уровнем защиты. Эти комплекты брони могут применяться как сбоку, так и спереди танков Abrams, чтобы обеспечить дополнительную защиту в соответствии с требованиями миссии. Армия также пытается профинансировать модернизацию системы управления огнем M1A1 с помощью того же пакета FLIR 2-го поколения на M1A2.

    M1A2 Abrams Основной боевой танк

    Задача танка M1A2 Abrams — сблизиться с силами противника и уничтожить их огневой мощью, маневром и ударным воздействием.M1A2 используется для бронетанковых батальонов и кавалерийских эскадрилий тяжелых сил. Вместо новой продукции армия модернизирует примерно 1000 старых Танки М1 в конфигурации М1А2. В ходе текущей программы закупок M1A2 Армией около 1000 старых, менее боеспособных танков серии M1 будут модернизированы до конфигурации M1A2 и переданы в действующие силы. В настоящее время не планируется отправлять M1A2 на ARNG. Армия закупила 62 новых танка в конфигурации A2 и по состоянию на начало 1997 года завершила переоборудование 368 старых M1 в M1A2.Еще 580 M1 модернизируются до A2 в соответствии с пятилетним контрактом, заключенным в 1996 финансовом году, при этом в общей сложности запланировано 998 обновлений M1. В 1999 финансовом году армия начнет модернизацию M1 до конфигурации M1A2 System Enhancement Program (SEP). Этот датчик также будет добавлен к более старым M1A2, начиная с 2001 финансового года. Когда SEP войдет в производство, в армии будет в общей сложности 627 M1A2, все из которых в конечном итоге будут преобразованы в конфигурацию SEP. Дальнейшие усовершенствования M1A2, названные программой улучшения системы (SEP), в стадии реализации, чтобы улучшить возможности цифрового управления танком и улучшить боеспособность и летальность танка.M1A2 SEP (System Enhancement Package) является центральным элементом цифрового поля боя для армии XXI. Это тяжелая машина, которая приведет Armor в следующее столетие и переведет боевые задачи ближнего боя в Future Combat System (FCS). M1A2 SEP — это улучшенная версия M1A2. Он содержит множество улучшений в области командования и управления, летальности и надежности. M1A2 SEP находится на заключительном этапе эксплуатационных испытаний, и его запуск на вооружение планируется в 2000 году. Планируется, что танки M1A2 SEP начнут поступать на вооружение в 3QFY00.Программа M1A2 System Enhanced Program (SEP) — это модернизация компьютерного ядра, которое является сутью танка M1A2. Обновление SEP включает улучшенные процессоры, цветные плоские дисплеи с высоким разрешением, увеличенный объем памяти, удобный интерфейс Soldier Machine Interface (SMI) и открытую операционную систему, которая обеспечит рост в будущем. Основные улучшения включают интеграцию перспективного инфракрасного прицела второго поколения (FLIR 2-го поколения), вспомогательного силового блока Under Armour (UAAPU) и системы управления тепловым режимом (TMS).Инфракрасная прицельная система 2-го поколения (2-е поколение FLIR) заменит существующую систему тепловизионных изображений (TIS) и независимую тепловизионную систему командира. Включение FLIR 2-го поколения в резервуар M1A2 потребует замены всех компонентов FLIR 1-го поколения. С точки зрения истребителя, это одно из ключевых улучшений SEP. FLIR 2-го поколения — это полностью интегрированная прицельно-прицельная система, предназначенная для обеспечения наводчика и командира танка значительно улучшенными возможностями обнаружения и поражения целей днем ​​и ночью.Эта система обеспечивает на 70% лучший захват, на 45% более быструю стрельбу и большую точность. Кроме того, увеличение дальности обнаружения и идентификации цели на 30% увеличит летальность и уменьшит братоубийство. Независимое тепловизионное устройство Commanders (CITV) обеспечивает возможность охотника-убийцы. FLIR 2-го поколения представляет собой прицельную систему с регулируемым увеличением в диапазоне от 3 до 6 (широкое поле зрения) для захвата цели и 13, 25 или 50 (узкое поле зрения) для поражения целей на соответствующем расстоянии.UAAPU состоит из газотурбинного двигателя, генератора и гидравлического насоса. Генератор способен производить 6 киловатт электроэнергии при 214 ампер, 28 в постоянного тока, а гидравлический насос способен выдавать 10 киловатт гидравлической энергии. UAAPU может обеспечить электрическую и гидравлическую мощность для управления всеми электронными и гидравлическими компонентами, используемыми во время установленных операций наблюдения, и зарядки основных аккумуляторов резервуара. UAAPU сократит эксплуатационные расходы и расходы на поддержку за счет использования того же топлива, что и резервуар, по сниженной цене — 3-5 галлонов в час работы.UAAPU установлен на левой задней части топливного элемента спонсона и весит 510 фунтов. Еще одним усовершенствованием M1A2 SEP является система управления тепловым режимом (TMS), которая поддерживает температуру в боевом отделении ниже 95 градусов, а температуру касания электронных блоков ниже 125 градусов в экстремальных условиях. За счет снижения температуры в боевом отделении для экипажа и электронных блоков это увеличивает боеспособность как солдат, так и машины. TMS состоит из блока обработки воздуха (AHU) и блока системы сжатия пара (VCSU), способного обеспечить 7.5 киловатт охлаждающей способности для бригады и линейных ремонтируемых блоков (LRU). AHU устанавливается в башне, а VCSU устанавливается впереди основного прицела наводчика (GPS). TMS использует экологически чистый хладагент R134a и смесь пропиленгликоля / воды для поддержания температуры касания LRU на уровне менее 140 градусов по Фаренгейту. TMS установлен в левой части башни башни и весит 384 фунта.

    Армия требует, чтобы все системы работали в Общей операционной среде армии (ACOE) для улучшения общевойсковых операций.Оцифровка и преобладание информации по всей армии для тактических элементов осуществляется с помощью программного обеспечения Force XXI Battle Command for Brigade and Lower (FBCB2). В Abrams программное обеспечение FBCB2 размещено на отдельной карте, которая обеспечивает ситуационную осведомленность по всему спектру тактических операций. Он улучшает поток сообщений с помощью 34 совместных переменных форматов сообщений, отчетов, начиная от отчетов о контактах и ​​заканчивая логистическими сводками, а также автоматически предоставляя местоположение транспортного средства дружественным системам.SEP позволяет распространять цифровые данные с улучшенной способностью оптимизировать операции на основе информации и поддерживать соответствующую общую картину при выполнении полноразмерных операций Force XXI. Это улучшение увеличивает способность контролировать темп боя, одновременно повышая летальность и живучесть. Наконец, чтобы обеспечить высокий уровень подготовки экипажа, каждый бронетанковый батальон имеет усовершенствованную систему подготовки стрелков (AGTS) с современной графикой.

    Изменения танка M1A2 Abrams, содержащиеся в программе улучшения системы (SEP) и конфигурации «M1A2 Tank FY 2000», предназначены для повышения летальности, живучести, мобильности, устойчивости и повышения ситуационной осведомленности, а также улучшений управления и контроля, необходимых для обеспечения информационного превосходства. доминирующей маневренной силе.Танк «Абрамс» и боевая машина «Брэдли» — два центральных компонента доминирующих цифровых сил маневра. Программа улучшения системы обновления предназначены для:
    • улучшают обнаружение, распознавание и идентификацию целей с добавлением двух FLIR 2-го поколения.
    • включает в себя вспомогательную силовую установку под броней для питания танка и сенсорных комплектов.
    • включают систему управления температурой для обеспечения экипажа и электроники охлаждение.
    • увеличивают скорость памяти и процессора и обеспечивают возможность полноцветной карты.
    • обеспечивает совместимость с армейской архитектурой командования и управления для обеспечить возможность обмена командованием и контролем и ситуационной осведомленностью со всеми компонентами общевойсковой команды.
    Дополнительное снижение веса, встроенное боевое управление, повышение живучести, управление сигнатурами, повышение безопасности и модификации продукта для M1A2 будут включать конфигурацию «M1A2 Tank FY 2000», предназначенную для подразделений цифрового дивизиона, начиная с 2000 финансового года.IOT & E M1A2 проводился с сентября по декабрь 1993 года в Форт-Худе, штат Техас, и состоял из этапа стрельбы и этапа маневра. Директор определил, что испытание было адекватным, M1A2 был оперативно эффективным, но не пригодным для эксплуатации и небезопасным. Эта оценка была основана на плохой доступности и надежности танка, случаях неуправляемого движения ствола и башни, непреднамеренного выстрела из пулемета 50-го калибра и горячих поверхностей, вызывающих контактные ожоги. FOT&E # 1 был проведен в сентябре-октябре 1995 года в связи с обучением новому оборудованию для двух подразделений размером с батальон.Несмотря на заверения армии в том, что все корректирующие действия были предприняты, многочисленные случаи неконтролируемого движения ствола и башни, блокировка независимого дисплея командира (CID) и контактные ожоги продолжались во время FOT & E # 1. Последующие испытания были отложены, и армия «поставила крайний срок» для двух батальонов танков M1A2 в Форт-Худе по соображениям безопасности. PM выявил 30 «основных причин» проблем с безопасностью и завершил обновление аппаратного и программного обеспечения в июне 1996 года, которые были оценены в FOT & E # 2.M1A2 TEMP был утвержден во втором квартале 1998 года. Этот TEMP включает согласованный план для FOT & E # 3 M1A2 в сочетании с IOT & E of Боевая машина Брэдли в 1999 финансовом году в Форт-Худ, штат Техас. Комбинированные боевые испытания будут состоять из 16 боевых действий между объединенной группой боевых машин Bradley Fighting Vehicle System-A3 / M1A2 SEP и общевойсковой командой M1A1 / Bradley-ODS. Кроме того, он будет служить в качестве эксплуатационных испытаний для FLIR 2-го поколения. Этот подход реализует идею министра обороны о совмещении тестирования, чтобы сэкономить ресурсы и обеспечить более реалистичную операционную среду.Армия и DOT&E завершили работу по оценке уязвимости и пришли к выводу, что «M1A2 Tank FY 2000» является значительным изменением по сравнению с исходной конструкцией M1A2 и потребует оценки живучести на уровне системы. Эта оценка будет основываться на полномасштабном тестировании на уровне системы двух систем, тестировании на уровне компонентов и подсистем, моделировании и симуляции, существующих данных и предыдущих тестах для оценки уязвимости и уязвимости «M1A2 Tank FY 2000» и его экипажа к ожидаемая угроза и оценить возможности ремонта боевых повреждений.Танк M1A2 Abrams с корректирующими действиями, предпринятыми менеджером программы в течение 96 финансового года, оценивается как эффективный и пригодный в эксплуатации. Были исправлены проблемы доступности, надежности, расхода топлива и безопасности, наблюдавшиеся в ходе предыдущих испытаний. FOT & E # 2 был проведен надлежащим образом в соответствии с утвержденными планами испытаний и Abrams TEMP. Не было зафиксировано случаев неконтролируемого движения ствола и башни, непреднамеренного выстрела из пулемета .50 калибра и горячих поверхностей, которые вызывали бы контактные ожоги в ходе предыдущих испытаний.Самая большая область технического риска для программы — это разработка Встроенное программное обеспечение Battle Command, которое предназначено для обеспечения дружественного и ситуационная осведомленность о противнике и обмен информацией о командовании и управлении во всей общевойсковой команде. Это программное обеспечение разрабатывается как программа горизонтального внедрения технологий и будет предоставлено системам вооружения и узлам C2 общевойсковой группы в FY00. Такой график разработки сопряжен с высоким риском и может отрицательно повлиять на график M1A2.

    Операции и поддержка

    В то время как M1A2 SEP и M1A1D обеспечивают улучшенные боевые возможности превосходного соответствия; Армия работает над повышением надежности, сокращением затрат на материально-техническое обеспечение и снижением затрат на эксплуатацию и поддержку [O&S] танка. Эти усилия сосредоточены на двух инициативах, которые обеспечивают войскам наибольшую «отдачу от вложенных средств» с точки зрения снижения затрат на эксплуатацию и обслуживание, повышения готовности и поддержания боевого превосходства.Эти инициативы включают следующую кампанию Abrams Engine и комплексную программу капитального ремонта Abrams Management (AIM):

    . Двигатель AGT 1500 хорошо послужил танку Abrams. Он обеспечивал значительное боевое преимущество благодаря легкости, мощности и незаметности. Однако AGT 1500 стареет, и автопарк сталкивается с проблемами в обслуживании этой рабочей лошадки. AGT 1500 представляет собой технологию 1960-х годов и снят с производства с 1992 года. Из-за снижения надежности на двигатель приходится около 64% ​​затрат на ремонт и обслуживание танков Abrams.Армия сосредотачивает внимание на двигателе как на главном элементе облегчения бремени технического обслуживания для войск при существенном сокращении затрат на эксплуатацию и обслуживание.

    PM Abrams разработал двухэтапную программу для повышения готовности двигателей и снижения затрат. На первом этапе новаторское использование партнерства с PM / AMC / промышленностью для капитального ремонта существующего двигателя / компонентов AGT 1500. Эта программа называется ПРОЗА (Партнерство по снижению затрат на эксплуатацию и обслуживание, двигатель). Согласно PROSE, правительство будет «объединяться» с производителем оригинального оборудования для реинжиниринга производственного процесса и улучшения поддержки на местах.Подрядчик предоставляет качественные детали и квалифицированную техническую поддержку, а государство (наши склады) предоставляет квалифицированную рабочую силу и оборудование.

    Второй этап инициативы по двигателям включает замену двигателя AGT 1500 новым двигателем. При реализации этого этапа существует большой потенциал для повышения готовности резервуаров и долгосрочного снижения затрат на эксплуатацию и обслуживание. Такой подход не будет дешевым и потребует от армии серьезного решения. Требуются инвестиции в размере 2 миллиардов долларов, чтобы заменить текущий двигатель новым двигателем в активном компоненте, а также потенциальную экономию в 13 миллиардов долларов за оставшийся срок службы танка.

    Ожидается, что процесс PROSE повысит надежность на 30%. Преимущества нового двигателя гораздо более значительны — армия может добиться повышения надежности в 4-5 раз, можно надеяться на снижение расхода топлива на 35%, уменьшение количества деталей на 42% и улучшение на 15-20%. в мобильности автомобиля. Согласно прогнозам, затраты на эксплуатацию и обслуживание двигателей в течение жизненного цикла снизятся с 16 миллиардов долларов за 30 лет с текущим двигателем до 3 миллиардов долларов с новым двигателем.

    Вторая часть нашей стратегии сокращения затрат на эксплуатацию и обслуживание — это программа Abrams Integrated Management (AIM).В процессе AIM проводится капитальный ремонт старого резервуара M1A1 в соответствии с исходными заводскими стандартами с применением всех применимых MWO. Доказательство принципа AIM было завершено в 1997 году, что доказало рентабельность концепции и помогло определить объем. Танк AIM продемонстрировал экономию затрат на эксплуатацию и техническое обслуживание на 18% по сравнению с танками без AIM. Концепция капитального ремонта AIM — это экономичное решение для решения проблем, связанных с ростом затрат на содержание резервуаров и растущими проблемами готовности.

    Центр данных по альтернативным видам топлива: основы этанольного топлива

    Этанол — это возобновляемое топливо, которое производится из различных растительных материалов, известных под общим названием «биомасса».«Более 98% бензина в США содержит этанол, обычно E10 (10% этанола, 90% бензина), который насыщает топливо кислородом, что снижает загрязнение воздуха.

    Этанол также доступен в виде E85 (или гибкого топлива), который может использоваться в транспортных средствах с гибким топливом, предназначенных для работы на любой смеси бензина и этанола до 83%. Другая смесь, E15, одобрена для использования в легковых автомобилях 2001 модельного года и более новых.

    Сделать этанол доступным в качестве автомобильного топлива необходимо в несколько этапов:

    • Сырье биомассы выращивается, собирается и транспортируется на предприятие по производству этанола.
    • Сырье превращается в этанол на производственном предприятии, а затем доставляется на топливный терминал или конечному потребителю по железной дороге, грузовиком или баржей.
    • Этанол смешивается с бензином на топливном терминале для получения E10, E15 или E85, а затем доставляется грузовиком на заправочные станции. E15 поступает либо непосредственно с терминала, либо через насос-блендер из резервуаров E10 и E85 на станции.

    Свойства топлива

    Этанол (CH 3 CH 2 OH) — прозрачная бесцветная жидкость.Он также известен как этиловый спирт, зерновой спирт и EtOH (см. Поиск по свойствам топлива). У этанола одна и та же химическая формула, независимо от того, произведен ли он из сырья на основе крахмала или сахара, такого как кукурузное зерно (поскольку это в первую очередь в Соединенных Штатах), сахарный тростник (как в основном в Бразилии) или из целлюлозного сырья (например, древесной щепы или растительных остатков).

    У этанола более высокое октановое число, чем у бензина, что обеспечивает превосходные свойства смешивания. Требования к минимальному октановому числу бензина предотвращают детонацию двигателя и обеспечивают управляемость.Бензин с более низким октановым числом смешивают с 10% этанолом, чтобы получить стандартное октановое число 87.

    Этанол содержит меньше энергии на галлон, чем бензин, в разной степени, в зависимости от процентного содержания этанола в смеси. Денатурированный этанол (98% этанола) содержит примерно на 30% меньше энергии, чем бензин на галлон. Влияние этанола на экономию топлива зависит от содержания этанола в топливе и от того, оптимизирован ли двигатель для работы на бензине или этаноле.

    Энергетический баланс этанола

    В США 94% этанола производится из крахмала кукурузного зерна.Для превращения любого исходного сырья в этанол требуется энергия. Этанол, произведенный из кукурузы, демонстрирует положительный энергетический баланс, а это означает, что процесс производства этанольного топлива не требует больше энергии, чем количество энергии, содержащееся в самом топливе.

    Целлюлозный этанол улучшает энергетический баланс этанола, поскольку исходным сырьем являются либо отходы, побочные продукты другой отрасли (древесина, пожнивные остатки), либо специальные культуры, такие как просо и мискантус, с меньшими потребностями в воде и удобрениях по сравнению с кукурузой.Когда биомасса используется для преобразования непищевого сырья в целлюлозный этанол, количество энергии ископаемого топлива, используемой в производстве, сокращается еще больше. Еще одно преимущество целлюлозного этанола заключается в том, что он приводит к более низким уровням выбросов парниковых газов в течение жизненного цикла.

    Для получения дополнительной информации об энергетическом балансе этанола загрузите следующие документы:

    требований к топливу и зажиганию при переходе с гоночного газа на метанол

    Если взять бензиновый тягач и настроить его на работу на метаноле, это не только повысит мощность, но и поможет автомобилю сбросить несколько килограммов.Это было направление, выбранным тюнером двигателей Джоном Коливасом, когда он превратил Mustang 96 года с турбонаддувом в гоночную машину, которая не требует минимального веса по правилам.

    «Чтобы максимально снизить вес автомобиля, мы заменили его топливом [VP Racing] M1», — говорит Коливас, добавляя, что улучшенные характеристики двигателя также помогли автомобилю снизить его личный рекорд и т. Д. после всего лишь нескольких проходов шейкдауна. «Он прошел быстрее, чем когда-либо прежде, всего за несколько пробежек. Это определенно выглядит многообещающе, и ему просто нужно больше кругов.”

    Чтобы конверсия прошла успешно, необходимо было решить проблемы как с топливом, так и с зажиганием. Поскольку у метанола меньше энергии, чем у бензина, в двигатель необходимо подавать больше топлива. Горючие свойства метанола также означали, что требовалась более мощная искра. В автомобиле уже был ЭБУ FuelTech FT600, поэтому проблема с топливом была решена с помощью более крупных форсунок и перенастройки топливных карт. Однако воспламенение требовало большего внимания, потому что традиционные решения для метанола обычно включают замену магнето.Тем не менее, команда хотела большей гибкости настройки, поэтому программируемый блок зажигания емкостного разряда FuelTech FTSPARK-8 вместе с компоновкой катушки на вилку был установлен и подключен к FT600.

    «До сих пор магнето было единственной доступной системой зажигания, способной обеспечивать такую ​​энергию», — говорит Андерсон Дик из FuelTech. «Он производит много энергии, но все больше людей используют задержку времени вместо отключения зажигания для любого вида управления питанием. Если вы ведете журнал, вы не можете отсчитывать время.”

    Динамометрические испытания шасси

    показали консервативную мощность в 2000 лошадиных сил для шин с преобразованием метанола.

    Дэниел Фаррис провел кампанию на Mustang в 2018 году, установив рекорд турбо в дивизионе NMCA Street Outlaw и выиграв одну гонку после трехкратного выхода в финал в шести выездных гонках. Коливас, который изначально построил автомобиль вместе с производителем двигателей Джоном Беннеттом из их магазина KBX Performance, затем заключил сделку по продаже Mustang Джеймсу Лоуренсу, который хотел получить автомобиль с турбонаддувом для непрекращающихся соревнований в стиле преступников.

    Автомобиль оснащен малолитражным двигателем Ford 430ci и двухступенчатой ​​коробкой передач с первой передачей 1,58: 1. Двигатель основан на алюминиевом блоке Bennett / Dart из заготовки с высотой деки 10.000 дюймов и выступом с выступом, который поддерживает 60-миллиметровые роликовые подшипники. Блок также обработан отверстиями подъемника шпоночной канавки 0,937 дюйма с измененными углами для корректировки геометрии с помощью приподнятого кулачка.

    Внутренние компоненты двигателя

    включают коленчатый вал Callies с ходом 4 000 дюймов, шатуны из стеклопластика, поршни Diamond, кольца Total Seal и подшипники с покрытием Calico.Ременный привод Danny Bee вращает распределительный вал Bennett из инструментальной стали, который приводит в действие подъемники Jesel.

    Новая система имеет прямой впуск от турбокомпрессора Precision во впускной коллектор.

    Головки цилиндров

    Edelbrock SC1 обработаны на станке с ЧПУ в соответствии со спецификациями Bennett и оснащены клапанами Victory, пружинами PSI и стальными коромыслами Jesel. Впускной коллектор CID соединяется с головками цилиндров, затем обрабатывается и оснащается специальной шляпкой и массивным 125-миллиметровым корпусом дроссельной заслонки Wilson.

    «Мы не использовали сухой картер из-за того, что автомобиль уже настроен на специальный масляный поддон и одноступенчатый внешний масляный насос», — говорит Беннетт. «Мы модифицировали существующую решетку, чтобы она соответствовала нашей заготовке. Алкоголь не повлияет на установку смазки, а это означает, что мы не будем обрабатывать спиртом любую систему по-разному ».

    Команда сохранила турбокомпрессор Gen II Precision 98 мм и систему впрыска топлива FuelTech FT600, последняя из которых должна была быть сделана для поддержки дополнительного топлива, которое необходимо было перекачивать и подавать в цилиндры.Первым делом, однако, было удаление промежуточного охладителя, резервуара для воды и связанных с ним трубопроводов из системы, что было бы не так полезно для метанола.

    «Теперь есть новая наддувная труба от турбонагнетателя к впуску. В целом мы вытащили из машины около 100 фунтов, — говорит Коливас. «Переход на M1 потребует вдвое большего расхода топлива».

    Вот компоненты автомобиля, удаленные при переводе на метанол. Пришлось изготовить новую шляпку для впускного коллектора, потому что оригинальная, показанная на фотографии, при повороте лицом вперед мешала капоту.Оригинальный блок зажигания также был удален, поскольку преобразование включает новую систему контроля искры, не требующую распределителя.

    Что такое метанол?

    Метанол — это кислородсодержащее топливо, которое сегодня обычно синтезируют из природного газа. Вначале метанол производился из древесины и широко использовался в Европе в качестве топлива для приготовления пищи. В начале -х годов века французский химик обнаружил, что метанол можно производить, используя окись углерода и водород.Поскольку ранее для производства шести галлонов метанола требовалась одна тонна древесины, новый синтетический метод стал предпочтительным производственным процессом, хотя за последние 120 лет он совершенствовался с использованием новых исходных материалов, включая уголь и природный газ.

    Метанол обладает рядом характеристик положительного сгорания, которые используются в гоночном двигателе. Данное количество воздуха может сжигать гораздо больше метанола в стехиометрических смесях, чем бензин, а максимальная мощность на метаноле обычно достигается в смесях, очень богатых стехиометрическими.Метанол также устойчив к детонации, поэтому обычно достигаются более высокие степени сжатия и более высокие уровни наддува. Высокая теплота испарения топлива будет достаточно охлаждать воздух, чтобы повысить объемный КПД. Другими словами, двигатели, работающие на метаноле, работают довольно холодно на максимальной мощности и обычно не требуют промежуточного охладителя в установках с форсированными двигателями.

    В середине 60-х годов метанол стал предпочтительным топливом для мероприятий USAC, в том числе Indy 500, где в 1964 году два водителя погибли в результате пожара, поданного бензином.В отличие от бензина, возгорание метанола можно потушить только водой. Кроме того, при возгорании метанола не возникает видимого пламени или дыма, поэтому водители встречного движения имеют более четкое поле зрения при приближении к аварии.

    Обратите внимание на внешний масляный насос с мокрым картером, который приводится в действие на половину скорости вращения коленчатого вала с помощью ременной передачи. Топливный насос Waterman установлен за масляным насосом. Также показаны отдельные катушки и пусковой механизм на демпфере системы зажигания.

    Метанол имеет относительно низкое энергосодержание, поэтому двигателю требуется повышенная подача топлива.Фактически, в определенных ситуациях огромный объем топлива, впрыскиваемого в двигатель, может влиять на давление в цилиндре до такой степени, что для компенсации требуется уменьшение статической степени сжатия двигателя. Однако в данном случае это было не так.

    Коливас заменил топливные форсунки на 225 фунтов в час на комплект Billet Atomizer 700 фунтов в час. Эти форсунки собираются вручную, проектируются и проходят испытания перед поставкой. Они разработаны для обеспечения постоянной дозировки от импульса к импульсу и распыления капель меньшего размера.

    «Я думаю, что эти форсунки находятся на уровне середины 80-х [процентов] рабочего цикла прямо сейчас, но турбонаддув выдает все ускорение, которое он собирается выдать. Так что насчет форсунок у нас все в порядке, — говорит Коливас. «Если когда-нибудь появится турбонагнетатель большего размера, например, 106 мм или 108 мм, нам, возможно, придется перейти на инжектор на 800 фунтов».

    Больше топлива, больше топлива!

    Коливас с самого начала знал, что насос на 6 галлонов в минуту не сможет удовлетворить потребность в подаче топлива более крупными форсунками.Ему пришлось увеличить объем и установить насос Waterman Racing Nostalgia Lil Bertha, который приводится в действие с задней стороны масляного насоса Peterson и настроен на расход 16,5 галлона в минуту. Теперь система обеспечивает базовый уровень 90 фунтов на квадратный дюйм и до 125 фунтов на квадратный дюйм, доступный в конце цикла.

    Насос Waterman Nostalgia Lil Bertha не соответствует своему названию «маленький», за исключением своего физического размера. Первоначально разработанный для приведения стандартной помпы Lil Bertha в соответствие с правилами гонок Nostalgia, между стандартной Lil Bertha и вариантом Nostalgia есть несколько ключевых отличий.«Ностальгия Lil Bertha была разработана для серии NHRA Hot Rod Heritage», — объясняет Шон Дилл, менеджер Waterman Racing. «Стандартный насос Lil Bertha имеет зубчатую полость шириной 1,7 дюйма. NHRA ограничила этот размер, поэтому мы создали Lil Bertha Nostalgia шириной всего 1,2 дюйма ».

    Представляем вам топливный насос Waterman Racing Nostalgia Lil ’Bertha поближе. Первоначально разработанные в соответствии с ограничительными правилами серии NHRA Hot Rod Heritage, дверные молотки, работающие со сложными системами суммирования мощности под капотом, быстро научились ценить компактный размер устройства и огромные возможности потока.

    Эта разница в размерах может показаться незначительной, но компактные размеры Nostalgia Lil Bertha не ускользнули от внимания гонщиков. «Когда у вас есть сложная комбинация турбонагнетателя или центробежного нагнетателя — со всеми видами водопровода в моторном отсеке — эти полдюйма в высоту и ширину становятся очень важными с точки зрения упаковки, — рассказывает Дилл.

    Благодаря сменным зубчатым передачам, диапазон мощности Lil Bertha может быть адаптирован до 23 галлонов в минуту номинального расхода топлива на верхнем пределе.«Мы стараемся, чтобы насос был примерно на 20-30 процентов выше максимального расхода форсунок», — объясняет Дилл. «Если у вас большой высокопроизводительный насос и вы используете только небольшую часть этого потока, все это топливо возвращается обратно в бак из регулятора. Если резервуар не идеально спроектирован с точки зрения перегородки или того, как возвратные потоки направляются в жидкость, в резервуаре могут происходить все виды перемешивания и аэрации, а затем, когда вы ставите ногу на пол, ваш резервуар становится пенистый, пенистый беспорядок, и вы получаете худощавое состояние.”

    В дополнение к универсальному диапазону мощности, Lil Bertha монтируется тремя отдельными способами: вертлюг с обратным вращением, V-образный бандаж со стандартным вращением или фланец с 4 болтами со стандартным вращением. В дополнение к вариантам монтажа он может приводиться в действие с помощью стандартного ременного привода или с помощью блока ременного привода с тросовым приводом, что еще больше увеличивает универсальность монтажа. Он также доступен со стальной центральной секцией, которая увеличивает коррозионную стойкость и деформацию устройства при экстремальных давлениях — обе ключевые переменные, когда вы говорите о зазорах, размер которых меньше.001 дюйм.

    «У него уже была достаточно большая система топливопровода, и топливный бак был установлен в передней части автомобиля», — говорит Коливас.

    Когда промежуточный охладитель и водопровод были на месте, индукционный колпак, или иногда называемый коленом, был перевернут, чтобы принимать заряд холодного воздуха из водяной камеры, которая была установлена ​​в салоне автомобиля. Теперь, когда турбонагнетатель поступает прямо во впускной коллектор, пришлось изготовить новую шляпу. Оригинальную шляпу нельзя было использовать, потому что при повороте лицом вперед она мешала зазору капота.

    Приводная к системе внешнего масляного насоса, Nostalgia Lil ’Bertha предлагает сменные зубчатые передачи для адаптации расхода топлива в точном соответствии с потребностями вашего приложения. Версия, которую мы использовали, предназначена для подачи 16,5 галлонов в минуту метанола с максимальной производительностью 23 галлона в минуту по сравнению с меньшей версией Nostalgia.

    Осветите все выключено

    Помимо замены топливных форсунок и насоса, другим критическим коэффициентом преобразования является зажигание.

    «До недавнего времени единственным выбором для запуска мощной алкогольной установки был магнето», — напоминает Коливас.«Очевидно, что запуск M1 требует точного контроля искры зажигания. Мы удалили установку распределительного типа и базовую коробку зажигания и установили FuelTech FTSPARK-8. Это позволяет вам настроить мощность искры, необходимую для настройки, на любом уровне мощности, который вы используете в автомобиле. Наша установка будет иметь мощность от 2000 до 2500 лошадиных сил, что никак не повлияет на FTSPARK-8 ».

    В новой системе зажигания удалены прежний распределитель и блок управления. Новый ремень FuelTech соединяется с восемью отдельными катушками.

    «Это довольно простой обмен», — добавляет Коливас. «Нам нужно было построить всего пару креплений для катушек».

    Одно из ключевых нововведений FTSPARK-8, которое делает его идеальным для метанола, — это возможность регулировать уровень энергии искры в дополнение к управлению синхронизацией искры. По данным компании, искра регулируется в диапазоне от 400 миллиджоулей (мДж) до 600 мДж.

    «Программируемая энергия искры позволяет тюнеру фактически использовать это как аспект настройки.Искра с более высокой энергией в конечном итоге может сжечь более бедные или более богатые смеси и в то же время привести к большему нагреву свечи », — говорит Андерсон.

    Определенные типы ограничителей оборотов и двухступенчатые могут затруднить восстановление двигателя при запуске, и этот период восстановления может быть непостоянным от запуска к запуску, что является недостатком для точной настройки. Тем не менее, запуск — это также и тогда, когда двигателю нужна горячая искра.

    «Вам необходимо немедленно восстановиться, чтобы полностью контролировать свой двигатель», — говорит Андерсон.«Поэтому всякий раз, когда вы хотите разрезать цилиндр, в следующем цикле вы хотите вернуть его на полную мощность, вам понадобится сильное зажигание, чтобы это сделать».

    Новая система зажигания тесно связана с ЭБУ FuelTech FT600, которая контролирует подачу топлива и синхронизацию зажигания. Он предлагает встроенный сенсорный дисплей, который позволяет выполнять определенные настройки без использования ноутбука.

    «Это мозговой ящик всей системы FuelTech», — говорит Коливас. «Это дает вам возможность менять мелодию на лету, вносить коррективы в промежуточные дорожки и коробку выгорания.Он дает вам пять предустановленных настроек на приборной панели. Вы можете войти прямо перед постановкой и полностью изменить карту, если хотите ».

    Вот два крупным планом массивных новых форсунок Billet Atomizer 700 фунт / час и колпака впускного коллектора.

    Управление мощностью во время пробежки может потребовать от тюнера возврата отсчета времени в определенные моменты пробежки. С FTSPARK-8 тюнер может также уменьшить мощность искры.

    «Вы стартуете с 600, потому что, возможно, именно здесь у вас есть транс-тормоз или какой-то тип трекшн-контроля», — объясняет Андерсон.«Затем вы используете настройку, чтобы увеличить мощность. Вы снова меняете мощность с 600 до 400 миллиджоулей, и они фактически покажут меньше тепла на вилке, что позволит вам расходовать немного меньше топлива и получить немного больше лошадиных сил. И все же будьте в безопасности и не повредите двигатель ».

    Автомобиль настроен на пробег только восьмую милю, поэтому карты топлива и времени настраиваются для этого расстояния с помощью ноутбука. Различия между картами основаны на различных сценариях трассы и производительности.

    «FTSPARK-8 имеет концентрацию 600 миллиджоулей за 300 микросекунд разряда. Это означает, что у нас более чем вдвое больше энергии, чем у магнита в начале искры », — говорит Андерсон. «Это важно, потому что на самом деле магнето может иметь даже 900 миллиджоулей, но при очень малой продолжительности. Это не концентрированная искра. FTSPARK-8 был разработан для спирта с очень концентрированной искрой в начале разряда. Если вы запускаете двигатель при 20 градусах времени, FTSPARK-8, вероятно, будет лучшей гарантией того, что ваш эффективный таймер составляет 20 градусов.”

    «Состояние трасс, разные кривые карданного вала, разные кривые частоты вращения двигателя», — говорит Коливас. «У нас также есть разные кривые наддува для разных кривых двигателя, разных кривых карданного вала и так далее. Когда вы подходите к линии, у вас есть пять наборов на выбор. Все масштабные настройки мы делаем с ноутбуком в боксах между раундами и между гонками. Затем вы загружаете карты, которые хотите запустить для этого трека. Обычно я загружаю один вниз, то есть немного медленнее, и один вверх, или немного быстрее.А потом все, что мне нужно сделать, это просто щелкнуть один, два или три, когда я поднимусь ».

    Коробка FuelTech FTSPARK-8 устанавливается за входной крышкой на впускном коллекторе.

    Стратегия настройки

    Что касается стратегии настройки, Коливас поддерживает постоянное соотношение воздух-топливо между различными картами.

    «Я не программирую пять, когда подхожу к очереди. Слишком много вариантов. По сути, у вас есть одна, две и три карты, а топливо и время в основном останутся прежними », — говорит Коливас.«Что изменится между тремя картами, так это кривая частоты вращения двигателя, кривая карданного вала и рампа наддува. Скажем, я собираюсь пробежать 4,30 и думаю, что трасса займет 1,10 60 футов. Но это не будет 4.35 или 4.40, тогда, очевидно, я собираюсь перейти к другой мелодии, которая имеет более низкую кривую двигателя, более низкую кривую карданного вала и, возможно, даже более низкую кривую наддува, чтобы достичь более медленного т. Д. И, может быть, на старте на 50 или 100 об / мин меньше. Иногда это также менялось между одной, двумя или тремя картами.”

    Джон Коливас (справа) работает с картами топлива и искры в системе FuelTech.

    Коливас говорит, что типичный запуск этого автомобиля может быть между 4100 и 4400 об / мин. Он добавляет, что турбонагнетатель обеспечит прибавку в 9 фунтов при старте на плохой трассе и до 12 или более на хорошей трассе.

    «И тогда это будет 38 фунтов», — говорит Коливас. «Если трасса будет не в хорошем состоянии, она может продвинуться еще дальше 38». И, очевидно, это контролируется моей кривой наддува.В некоторых забегах мы можем полностью разогнаться на 1,2 или 1,4 секунды. Еще одна пробежка, и мы сможем разогнаться только через две секунды ».

    Система FuelTech FT600 включает в себя ЭБУ со встроенным монитором. Это позволяет водителю «на лету» вносить изменения в полосу движения.

    После переоборудования первые запуски динамометрического стенда были очень многообещающими.

    «На динамометрическом стенде автомобиль показал себя безупречно, без проблем. «При консервативной настройке мы увеличили мощность шин до 2000 лошадиных сил», — резюмирует Коливас.«Это было существенное увеличение по сравнению с предыдущими расходами на бензин. С настройками M1, очевидно, требуется немного больше обслуживания. Масло меняют чаще, а износ подшипников мы проверяем после 15-20 прогонов. Это по сравнению с целым сезоном на бензине. Мы чувствуем, что с увеличенным одиночным турбонагнетателем и немного большим снижением веса этот автомобиль может легко проехать 4-х дюймов, если не 4,0 с ».

    Эволюционное происхождение и появление высокоуспешного клона стрептококка серотипа M1 группы А, вызвавшего множественные события горизонтального переноса генов | Журнал инфекционных болезней

    Аннотация

    Чтобы лучше понять молекулярные события, вовлеченные в происхождение новых патогенных бактерий, мы изучили эволюцию высоковирулентного клона серотипа M1 группы A Streptococcus (GAS).Анализ геномного, ДНК-ДНК-микрочипа и однонуклеотидного полиморфизма показал, что этот клон эволюционировал в результате серии событий горизонтального переноса генов, которые включали (1) приобретение профагов, кодирующих стрептококковый пирогенный экзотоксин А и внеклеточные ДНКазы и (2) реципрокную рекомбинацию. хромосомной области размером 36 т.п.н., кодирующей внеклеточные токсины NAD + -гликогидролаза (NADase) и стрептолизин O (SLO). Эти события переноса генов были связаны со значительным увеличением продукции SLO и NADase.Виртуальная идентичность в области 36 т.п.н., присутствующей в современных изолятах серотипов M1 и M12, предполагает, что штамм серотипа M12 служил донором этой области. Множественные события горизонтального переноса генов были решающим фактором в эволюционном происхождении и появлении очень многочисленного современного клона серотипа M1 GAS

    .

    Молекулярные события, вовлеченные в появление необычно вирулентных патогенов, плохо изучены. Бактерии могут развиваться медленно за счет накопления точечных мутаций или быстро в «эволюционном квантовом скачке» за счет приобретения нового генетического материала посредством событий горизонтального переноса генов [1].Новые комбинации генов или аллельных вариантов могут повысить приспособленность бактерий, придавая им уникальные свойства, такие как способность колонизировать ранее неиспользуемую экологическую нишу или противостоять компонентам иммунной системы. Известно, что ряд хорошо описанных процессов способствует событиям горизонтального переноса генов, включая трансдукцию профага, конъюгацию плазмиды и трансформацию

    Группа A Streptococcus (GAS) ответственна за многие серьезные инфекции человека, такие как некротический фасциит (NF; также называемый «синдром поедания плоти») и синдром стрептококкового токсического шока (STSS) [2, 3].Однако наиболее распространенными формами стрептококковой инфекции являются неинвазивные, не опасные для жизни инфекции, такие как фарингит и импетиго. Факторы хозяина и бактерии влияют на исход инфекции [4]. Важность GAS-факторов в проявлении болезни была частично определена из-за неслучайного распределения серотипов GAS среди конкретных заболеваний. Например, в популяционных сериях случаев серотип M1 GAS обычно является наиболее распространенным серотипом, выявляемым во время эпизодов инвазивного заболевания [5–7]

    В середине 1980-х годов частота и тяжесть инвазивных инфекций, вызванных серотипом M1 GAS (е.g., сепсис, STSS и, особенно, NF) внезапно и резко усилились (см. обзор Musser and Krause [3]). Однако мало что известно о молекулярных процессах, связанных с этим фенотипическим сдвигом. В настоящем исследовании мы стремились понять молекулярные события, которые способствуют эволюционному происхождению и появлению штаммов GAS серотипа M1 с помощью геномного, однонуклеотидного полиморфизма (SNP), транскриптома и анализа белков

    Материалы и методы

    Секвенирование генома Геном штамма MGAS5005 был секвенирован методами, ранее использовавшимися для секвенирования генома штаммов GAS серотипов M6 и M28 [8, 9].Было проведено направленное секвенирование, чтобы повысить минимальное качество консенсусной основы до Q40 для областей с низким качеством последовательности в собранном геноме. После закрытия весь геном был разделен методом полимеразной цепной реакции (ПЦР), чтобы убедиться в достоверности сборки. Открытые рамки считывания (ORF) были идентифицированы с помощью проприетарного программного обеспечения (Integrated Genomics) и были введены в набор биоинформатики ERGO для аннотации [10]. Последовательность генома депонирована в GenBank (номер доступа CP000017).Штамм MGAS5005 депонирован в Американской коллекции типовых культур (номер BAA-947)

    Бактериальные штаммы Были изучены шестьдесят пять штаммов GAS серотипа M1 (таблица 1). Выборка этих организмов была основана на генетическом анализе ~ 2000 штаммов серотипа M1, выделенных от пациентов на нескольких континентах. Эти исследования проводились в течение последних 13 лет в лаборатории старшего автора (J.M.M.). Важно отметить, что эти ~ 2000 штаммов серотипа M1 включают организмы из всесторонних популяционных исследований, проводимых в течение многих лет в США, Канаде, Германии и Финляндии [11–16].Отбор штаммов для молекулярного анализа проводился случайным образом на основе наших знаний о распределении субклонов серотипа M1, присутствующих в изученных популяциях. Дополнительные изученные штаммы были отобраны случайным образом из коллекции штаммов старшего автора, которая включает> 12 000 изолятов из 36 стран мира. Изученные штаммы не подвергались систематической систематической ошибке выборки. Критерии включения были разработаны таким образом, чтобы предоставить для исследования разнообразную во времени и пространстве коллекцию изолятов.MGAS5005 был выделен в 1996 г. из спинномозговой жидкости инфицированного пациента в Онтарио, Канада, и широко использовался в исследованиях патогенеза ГАЗ [17–19]

    Таблица 1

    Изоляты Streptococcus группы A серотипа M1

    Таблица 1

    Изоляты Streptococcus группы A серотипа M1 исследованы

    Анализ ДНК-ДНК-ДНК GAS Для гибридизации ДНК-ДНК использовали два микрочипа с пятнами сравнить старые и современные изоляты GAS серотипа M1.Двадцать девять изолятов, 21 из которых был выделен в Финляндии в рамках популяционного исследования, были проанализированы с использованием микрочипа ДНК, содержащего 1702 ORF, что составляет 97% генома штамма SF370 серотипа M1 [20]. Кроме того, эти изоляты были проанализированы с использованием микроматрицы GAS, состоящей из 1702 ORF M1, дополненных ORF, уникально присутствующими (относительно штамма SF370) в штамме MGAS8232 серотипа M18 [21] и штамме MGAS315 серотипа M3 [22]. Большинство дополнительных ORF кодируется профагами, присутствующими в геноме секвенированных штаммов серотипа M3 и M18.SF370 был выделен в 1985 г. из инфицированной раны пациента, и этот изолят обладает низкой активностью NAD + -гликогидролазы (NADase), как и все изоляты GAS серотипа M1 до 1988 г. [20, 23]

    Бактерии выращивали в течение ночи. в бульоне Тодда-Хьюитта (Difco Laboratories) с добавлением 0,2% дрожжевого экстракта (бульон THY). Хромосомную ДНК выделяли с использованием набора для выделения ДНК Puregene (Gentra Systems). Эксперименты по приготовлению зонда и гибридизации микрочипов выполняли, как описано в [21, 24].Пятна дифференциальной гибридизации были идентифицированы для каждого штамма с использованием программного обеспечения для анализа QuantArray (Packard BioScience). ORF, определенные как «отсутствующие», либо не присутствовали в геноме тестируемого штамма, либо имели последовательности, достаточно расходящиеся для предотвращения гибридизации с ДНК штамма SF370 в очень жестких условиях. Результаты микроматрицы ДНК-ДНК были подтверждены картированием ПЦР и целевым секвенированием ДНК.

    Анализ SNP Праймеры ПЦР были сконструированы для фланкирования областей, содержащих предполагаемые SNP (таблица 2).ПЦР-амплификации очищали с использованием набора для очистки ПЦР Qiagen, а затем секвенировали как с прямым, так и с обратным праймерами. Данные SNP для каждого штамма были объединены в одну строку символов (нуклеотидную последовательность). Филогенетический анализ был выполнен с использованием MEGA (версия 2.1; доступен по адресу: http://www.megasoftware.net/) с методом объединения соседей, в котором используются 1000 бутстраповских реплик, а расстояние рассчитывается на основе числа различных SNP

    Таблица 2

    Праймеры полимеразной цепной реакции, используемые для анализа однонуклеотидного полиморфизма (SNP)

    Таблица 2

    Праймеры полимеразной цепной реакции, используемые для анализа однонуклеотидного полиморфизма (SNP)

    Вестерн-иммуноблот-анализ белков культурального супернатанта Бактерии выращивали до экспоненциальной фазы (OD 600 , 0.25) или стационарной фазы (в течение ночи), а супернатанты культур получали центрифугированием и фильтрованием через фильтр 0,45 мкм. Белок концентрировали осаждением этанолом и анализировали на присутствие стрептолизина O (SLO) и НАДазы методами, описанными в другом месте [19]

    Анализ ферментативной активности НАДазы Активность НАДазы, секретируемой из старых и современных изолятов, анализировали, как описано в другом месте [25]. Вкратце, супернатанты ночных культур центрифугировали и фильтровали через фильтр 0.Фильтр 45 мкм. Двухкратные серийные разведения супернатантов проводили в микротитровальных планшетах с PBS. NAD + (Sigma), разведенный в PBS, добавляли до концентрации 0,67 ммоль / л перед инкубацией в течение 1 ч при 37 ° C. Реакции развивались добавлением NaOH к 2 н., Инкубировались в течение 1 ч в темноте и считывались макроскопически, возбуждая образцы светом с длиной волны 360 нм. Результаты представлены как наивысшее 2-кратное разведение, способное гидролизовать 100 нмоль экзогенного НАД +

    Анализ ферментативной активности SLO Активность SLO, секретируемая из старых и современных изолятов, оценивали, как описано в другом месте [26], с небольшими доработками.Вкратце, штаммы выращивали до OD 600 0,25 ± 0,05, а супернатанты осветляли центрифугированием и фильтрацией (размер пор 0,22 мкм). Очищенный супернатант инкубировали с дитиотреитолом 20 ммоль / л в течение 10 мин при комнатной температуре и аликвотировали (500 мкл) в 2 пробирки. Водорастворимый холестерин (25 мкг) (холестерин / метил-β-циклодекстрин; Sigma-Aldrich), специфический ингибитор SLO, добавляли к одному образцу, и образцы инкубировали при 37 ° C в течение 30 минут. К каждому образцу добавляли 2% суспензию эритроцитов барана / PBS (250 мкл), перемешивали путем переворачивания и инкубировали в течение 30 мин при 37 ° C.К каждому образцу добавляли PBS (500 мкл) и нелизированные эритроциты удаляли центрифугированием при 3000 g в течение 5 минут. Количество гемоглобина, присутствующего в супернатанте, измеряли анализом оптической плотности при 541 нм. Эритроциты, инкубированные в воде, служили положительным контролем (100%) для лизиса, а свежий бульон THY использовали в качестве отрицательного контроля. Контроли обрабатывали точно так же, как экспериментальные образцы, за исключением того, что среда, а не PBS добавлялась к образцу воды на последнем этапе.

    Анализ экспрессии на микрочипе Affymetrix GeneChip Недавно описанный заказной Affymetrix GeneChip использовался для исследований экспрессии на микрочипе. сравнить старые и современные изоляты GAS генотипа M1 [27].Чип состоял из массива антисмысловых олигонуклеотидов (размером 18 микрон), который представлял> 400000 25-мерных зондов (16 пар / набор зондов). Он содержал наборы зондов (42 351 признак) для 2662 предсказанных ORF для GAS, которые представляли собой составной расширенный набор из 6 последовательностей генома GAS (M1, M3, M5, M12, M18 и M49). Чип также содержал 1925 избыточных наборов зондов, которые вместе представляли> 95% неизбыточных предсказанных кодирующих областей в геноме штамма SF370

    Транскриптомы 6 изолятов GAS серотипа M1 с генами covRS дикого типа, которые кодируют 2- компонент системы передачи сигнала, который регулирует ~ 15% генома GAS [28], сравнивали с помощью анализа экспрессии микрочипов.Четыре из этих изолятов (MGAS2221, MGAS5322, MGAS1284 и MGAS5087) имели генотип филогенетической линии, аналогичный генотипу штамма MGAS5005, тогда как другие 2 изолята (MGAS1264 и MGAS1508) имели генотип филогенетической линии, сходный с генотипом штамма SF370 (см. Результаты ). Изоляты выращивали в течение ночи в бульоне THY при 37 ° C в 5% CO 2 . На следующее утро 2 культуры каждого изолята засевали разведением 1: 100 ночных культур в свежем, предварительно нагретом бульоне THY и инкубировали при 37 ° C в 5% CO 2 .РНК получали из каждой из 12 культур, которые выращивали до OD 600 0,14 (ранняя экспоненциальная фаза). Выделение РНК, синтез кДНК, мечение и гибридизацию выполняли, как описано в другом месте [27]. Оценки экспрессии генов были рассчитаны для каждого чипа с использованием GCOS (версия 1.1.1; Affymetrix). Данные GAS-специфичных чипов были нормализованы по образцам, чтобы минимизировать расхождения из-за экспериментальных переменных (например, подготовка зонда и гибридизация). Двухвыборочный тест Стьюдента t (неравная дисперсия) был применен к данным с помощью Partek Pro (версия 5.1; Partek) с последующей поправкой на частоту ложного обнаружения (P <0,05) для учета множественного тестирования [27]

    Сравнение промоторов Промоторные области из интересующих генов в MGAS5005 и SF370 были выровнены с использованием ClustalW, доступный на веб-сайте Network Protein Sequence Analysis [29]

    Результаты

    Вариации содержания генов в штаммах GAS серотипа M1 Анализ ДНК-ДНК с помощью микроматрицы выявил ограниченные различия в содержании генов среди 30 изолятов серотипа M1 из 6 стран (рис. 1).Все штаммы имели очень похожие ядерные геномы, соответствующие 93% ORF, присутствующих в геноме эталонного штамма SF370 серотипа M1 [20]. Максимум 113 ORF (7%) отсутствовали в одном тестовом штамме по сравнению с таковыми в контрольном штамме, и практически все изменяющиеся ORF были связаны с профагами (рисунок 1). У большинства штаммов отсутствовали 3 из 4 профагов, присутствующих в контрольном штамме. Два дополнительных профага (ϕ5005.1 и ϕ5005.3; см. Ниже) были идентифицированы в недавно выделенных изолятах с помощью ДНК-микрочипа, дополненного ORF, присутствующими в секвенированных геномах серотипов M3 и M18 [21, 22].Один геномный профиль преобладал среди современных изолятов (рис. 1), что согласуется с гипотезой недавнего глобального распространения отдельного клона серотипа M1 [11, 12, 30]

    Рисунок 1

    Схема сравнения содержания гена 29 изолятов Streptococcus (GAS) серотипа M1 группы A и эталонного штамма SF370. Хромосомное положение каждого гена SF370 (1702 открытых рамки считывания [ORF]) показано сверху вниз. Содержание генов 29 изолятов серотипа M1 относительно штамма SF370 показано слева направо.Изоляты сгруппированы на основании наличия или отсутствия гена speA . Гены были идентифицированы как присутствующие (красный) отсутствующие (черные) или дивергентные (зеленый) с помощью анализа микроматриц, картирования полимеразной цепной реакции и целевого секвенирования. Под каждым обозначением профага указаны предполагаемые гены фактора вирулентности, присутствующие в профаге.

    Рисунок 1

    Схема сравнения содержания гена 29 изолятов Streptococcus серотипа M1 группы A (GAS) и эталонного штамма SF370.Хромосомное положение каждого гена SF370 (1702 открытых рамки считывания [ORF]) показано сверху вниз. Содержание генов 29 изолятов серотипа M1 относительно штамма SF370 показано слева направо. Изоляты сгруппированы на основании наличия или отсутствия гена speA . Гены были идентифицированы как присутствующие (красный) отсутствующие (черные) или дивергентные (зеленый) с помощью анализа микроматриц, картирования полимеразной цепной реакции и целевого секвенирования.Под каждым обозначением профага указаны гены предполагаемых факторов вирулентности, присутствующие в профаге

    Вместе с результатами предыдущих исследований [11–14] эти данные предполагают, что эталонный штамм SF370 генетически отличается от штаммов серотипа M1, ответственных за самые последние человеческие инфекции. Чтобы изучить этот вопрос более подробно, мы секвенировали геном штамма MGAS5005, организма серотипа M1, который является генетически репрезентативным для современных изолятов и широко используется в исследованиях патогенеза [17, 18, 31].В соответствии с данными анализа ДНК-ДНК на микрочипах геномы штаммов MGAS5005 и SF370 были очень похожи (рис. 2А). Однако геномы различались по содержанию профага, небольшим вставкам и делециям и множеству SNP. Профаги составляли большинство ORF, специфичных для штаммов. Геном штамма MGAS5005 содержал 3 профага (рисунок 2B), кодирующих всего 3 доказанных или предполагаемых фактора внеклеточной вирулентности — мощный пирогенный токсин-суперантиген (токсин скарлатины, вариант SpeA2 [32]) и 2 ДНКазы (Spd3 и SdaD2 [19, 33])

    Рисунок 2

    Атлас , сравнивающий хромосомы штаммов SF370 и MGAS5005.Анализ BLAST был выполнен для сравнения открытых рамок считывания (ORF) MGAS5005 с рамками SF370. Цветной круг представляет все ORF MGAS5005, при этом ORF с высокой гомологией (≥ e −10 ) имеют желтый цвет, а ORF с низкой гомологией или уникальные ORF (< e −10 ) имеют синий цвет. . Красные блоки за пределами круга показывают расположение профагов MGAS5005; зеленые блоки и стрелки внутри круга показывают расположение и сайты вставки, соответственно, профагов SF370.Также отмечено расположение М12-подобной области размером 36 т.п.н. B Организация и карта ORF 3 профагов, присутствующих в геноме штамма MGAS5005. Предполагаемые ORF указаны стрелками, которые показывают направление транскрипции. Группы генов, белковые продукты которых функционально связаны, обозначены цветом.

    Рисунок 2

    A Атлас, сравнивающий хромосомы штаммов SF370 и MGAS5005. Анализ BLAST был выполнен для сравнения открытых рамок считывания (ORF) MGAS5005 с рамками SF370.Цветной круг представляет все ORF MGAS5005, при этом ORF с высокой гомологией (≥ e −10 ) имеют желтый цвет, а ORF с низкой гомологией или уникальные ORF (< e −10 ) имеют синий цвет. . Красные блоки за пределами круга показывают расположение профагов MGAS5005; зеленые блоки и стрелки внутри круга показывают расположение и сайты вставки, соответственно, профагов SF370. Также отмечено расположение М12-подобной области размером 36 т.п.н. B Организация и карта ORF 3 профагов, присутствующих в геноме штамма MGAS5005.Предполагаемые ORF указаны стрелками, которые показывают направление транскрипции. Группы генов, белковые продукты которых функционально связаны, обозначены цветом

    Анализ SNP 65 штаммов GAS серотипа M1 Наличие двух геномных последовательностей облегчило анализ генетических взаимоотношений между штаммами GAS серотипа M1 с высоким разрешением посредством полногеномного исследования SNP. Генетические отношения между 65 географически и временно различающимися изолятами GAS серотипа M1 были исследованы путем анализа 37 подтвержденных последовательностью SNP, которые распределены по всему геному (таблицы 1 и 2).Изоляты, извлеченные до середины 1980-х годов, были генетически гетерогенными, о чем свидетельствует вариация в генотипе SNP (рис. 3). В отличие от этого, практически все недавние изоляты имели один и тот же генотип SNP, независимо от места их происхождения, что подтверждает их клональное родство вследствие недавнего общего происхождения (рис. 3)

    Рисунок 3

    Генетические отношения между 65 изолятами Streptococcus (GAS) серотипа M1 группы A , согласно анализу однонуклеотидного полиморфизма (SNP).Было проанализировано тридцать семь SNP в каждом из 65 штаммов. 37 SNP расположены в среднем на расстоянии 50 т.п.н. друг от друга на основной хромосоме GAS. Штамм MGAS315 серотипа M3 был использован в качестве внешней группы.

    Рисунок 3

    Генетические отношения между 65 изолятами Streptococcus (GAS) серотипа M1 группы A , согласно анализу однонуклеотидного полиморфизма (SNP). Было проанализировано тридцать семь SNP в каждом из 65 штаммов. 37 SNP расположены в среднем на расстоянии 50 т.п.н. друг от друга на основной хромосоме GAS.Штамм MGAS315 серотипа M3 использовался в качестве внешней группы

    Сравнение хромосомной области размером 36 т.п.н. между изолятами генотипа M1 и M12 Большинство SNP, которые дифференцируют штаммы SF370 и MGAS5005, были распределены по геному явно случайным образом. Однако область размером 36 т.п.н., расположенная между purA и nadC , имела чрезмерное количество SNP (рисунок 4). Этот необычный паттерн изменчивости SNP предполагает, что области 36 т.п.н. из этих двух штаммов имеют эволюционную историю, весьма отличную от таковой для остальных основных геномов.Сравнение области 36 т.п.н., присутствующей в штамме MGAS5005, с нашей собственной базой данных генома GAS выявило его виртуальную идентичность с аналогичным хромосомным сегментом, присутствующим в 2 штаммах серотипа M12 (рисунок 4 и данные не показаны). Однако, разительно контрастируя с этим, последовательность области 36 т.п.н. в штамме SF370 значительно различалась (рис. 4). Это наблюдение было подтверждено повторным секвенированием 10 081 п.н., расположенных в области 36 т.п.н., присутствующей в штаммах SF370 (M1), MGAS5005 (M1) и MGAS9429 (M12). Более того, анализ 45 SNP в области 36 т.п.н. в каждом из 65 штаммов серотипа M1 из различных географических источников подтвердил ключевой вывод о том, что старые (до 1988 г.) и более современные (после 1988 г.) штаммы серотипа M1 различаются по этому хромосомному сегменту. .В совокупности данные убедительно свидетельствуют о том, что участок длиной 36 т.п.н. в современных штаммах M1 был получен совсем недавно из штамма GAS серотипа M12 путем горизонтального переноса генов и рекомбинационной замены

    .

    Рисунок 4

    Карта открытой рамки считывания (ORF) области 51 т.п.н. в геномах штаммов MGAS9429 (серотип M12), MGAS5005 (серотип M1) и SF370 (серотип M1). На схеме показаны границы предполагаемого горизонтального переноса генов между M-типами с участием ~ 36 т.п.н. ДНК.Красная заливка между открытыми рамками считывания указывает на 100% идентичность на уровне нуклеотидов. Участки MGAS5005 и MGAS9429 размером 36 т.п.н. идентичны, за исключением 6 однонуклеотидных полиморфизмов (SNP; обозначены звездочками) и 1 делеции в рамке считывания (Δ). Для сравнения, участки MGAS5005 и SF370 размером 36 т.п.н. различаются на 435 SNP и 5 делеций. Отмечены выбранные интересующие гены. ORF транспозазы показаны серым цветом.

    Рисунок 4

    Карта открытой рамки считывания (ORF) области 51 т.п.н. в геномах штаммов MGAS9429 (серотип M12), MGAS5005 (серотип M1) и SF370 (серотип M1).На схеме показаны границы предполагаемого горизонтального переноса генов между M-типами с участием ~ 36 т.п.н. ДНК. Красная заливка между открытыми рамками считывания указывает на 100% идентичность на уровне нуклеотидов. Участки MGAS5005 и MGAS9429 размером 36 т.п.н. идентичны, за исключением 6 однонуклеотидных полиморфизмов (SNP; обозначены звездочками) и 1 делеции в рамке считывания (Δ). Для сравнения, участки MGAS5005 и SF370 размером 36 т.п.н. различаются на 435 SNP и 5 делеций. Отмечены выбранные интересующие гены. Открытые рамки считывания транспозаз показаны серым цветом.

    Сравнение активности SLO и NADase между старыми и современными изолятами M1 Два известных внеклеточных токсина кодируются генами, присутствующими в этой области размером 36 т.п.н.: SLO и NADase.SLO — мембранолитический токсин [26]. NADase ингибирует интернализацию GAS клетками-хозяевами, индуцирует апоптоз и оказывает сильное пагубное воздействие на полиморфно-ядерные лейкоциты человека, тем самым увеличивая выживаемость GAS [23, 25, 34]. Важно отметить, что штаммы серотипа M1, выделенные до середины 1980-х годов, по сообщениям, не продуцируют НАДазу, хотя они действительно содержат интактный ген (nga) для этого фермента [23, 34–38]. Напротив, штаммы серотипа M12 (независимо от года выделения) и штаммы серотипа M1, выделенные после середины 1980-х годов, действительно продуцируют НАДазу [23, 26, 34–37].Кроме того, известно, что пациенты, инфицированные штаммами серотипа M12, сероконверсируют в НАДазу, что указывает на продукцию in vivo у людей [34, 39, 40]. Таким образом, мы предположили, что современные изоляты серотипа M1 (профиль SNP, подобный MGAS5005 с областью 36 т.п.н., подобной M12), могут продуцировать внеклеточную НАДазу. Эта гипотеза была подтверждена вестерн-анализом иммуноблоттинга (фиг. 5А). Иммунологически реактивный белок также присутствовал в супернатантах более старых изолятов (SF370-подобных), хотя и на значительно более низких уровнях.Также наблюдалось сопутствующее увеличение активности НАДазы в супернатантах современных изолятов по сравнению с более старыми изолятами (P <0,01) (рис. 5B). SLO имел аналогичную картину повышенного уровня белка и активности в супернатантах современных изолятов (P <0,01) (рис. 5A и 5C)

    Рисунок 5

    Обнаружение стрептолизина O (SLO) и NAD + -гликогидролаза (NADase) в культуральном супернатанте соответствующего заболеванию старого (до 1988 г.) и современного (после 1988 г.) серотипа M1 группы A Streptococcus (ГАЗ) изолирует. A SDS-PAGE концентрированных супернатантов культур из MGAS5005-подобных (красный) или SF370-подобных (черный) GAS, зондированных антителом против SLO. Известно, что это антитело перекрестно реагирует как с SLO, так и с NADase из-за физической ассоциации этих белков в препарате иммунизирующего антигена. B Анализ ферментативной активности НАДазы, с указанием активности как наивысшего 2-кратного разведения, способного гидролизовать 100 нмоль экзогенного НАД + . Эксперимент проводился в трех повторностях, с результатами, идентичными показанным в каждом случае. C Анализ активности фермента SLO, с указанием активности в процентах от активности относительно MGAS5005. Эксперимент проводили в трех экземплярах; показаны средние значения, с полосами ошибок, указывающими SD

    Рисунок 5

    Обнаружение стрептолизина O (SLO) и NAD + -гликогидролазы (NADase) в культуральном супернатанте сопоставимых по болезни старых (до 1988 г.) и современных ( после 1988 г.) изолятов серотипа M1 группы A Streptococcus (GAS). A SDS-PAGE концентрированных супернатантов культур из MGAS5005-подобных (красный) или SF370-подобных (черный) GAS, зондированных антителом против SLO.Известно, что это антитело перекрестно реагирует как с SLO, так и с NADase из-за физической ассоциации этих белков в препарате иммунизирующего антигена. B Анализ ферментативной активности НАДазы, с указанием активности как наивысшего 2-кратного разведения, способного гидролизовать 100 нмоль экзогенного НАД + . Эксперимент проводился в трех повторностях, с результатами, идентичными показанным в каждом случае. C Анализ активности фермента SLO, с указанием активности в процентах от активности относительно MGAS5005.Эксперимент проводили в трех экземплярах; показаны средние значения с полосами ошибок, указывающими SD

    Сравнение глобальной экспрессии генов между старыми и современными изолятами M1 Наши генетические данные показали, что штаммы серотипа M1 с клональным генотипом, аналогичным таковому штамму MGAS5005, были ответственны за необычно тяжелые инфекции, возникшие после середины 1980-х гг. Это согласуется с нашим предыдущим открытием, что у мышей штамм MGAS5005 более вирулентен, чем штамм SF370 [31].Хотя мы считали вероятным, что различия в экспрессии SLO, NADase и факторов вирулентности, кодируемых профагом, способствовали фенотипу высокой вирулентности, также возможно, что представители более позднего субклона M1 отличались от более старых штаммов по своей экспрессии. многих других генов. Чтобы проверить эту гипотезу, транскриптомы 4 штаммов с генотипом филогенетической линии, аналогичным генотипу штамма MGAS5005, и 2 штамма с генотипом филогенетической линии, аналогичным генотипу штамма SF370 GAS, сравнивали с использованием Affymetrix GeneChip.Все эти 6 штаммов имеют аллель дикого типа covR и covS . Было обнаружено, что только 8 основных хромосомных генов дифференциально транскрибируются (≥2-кратное изменение уровня транскрипта) между SF370-подобными и MGAS5005-подобными изолятами (рис. 6). Все 8 генов были более высоко экспрессированы в изолятах, подобных MGAS5005, при этом 5 из этих 8 генов присутствовали в области ДНК размером 36 т.п.н., участвующих в событии горизонтального переноса генов (фигура 6). В соответствии с результатами анализа внеклеточного белка (рисунок 5), 2 из этих генов были slo и nga

    .

    Рисунок 6

    Анализ экспрессии на микрочипах транскриптомов SF370-подобных и MGAS5005-подобных изолятов.Показаны значения log 2 кратного изменения средних уровней транскриптов основных хромосомных генов, которые значительно различаются (P <0,05, тест Стьюдента t с последующей поправкой на частоту ложных открытий для учета множественных сравнений). ), с как минимум 2-кратным изменением экспрессии между SF370-подобными и MGAS5005-подобными изолятами. Красные и синие точки данных относятся к наличию или отсутствию этих генов в горизонтально перенесенной области размером 36 т.п.н., соответственно.

    Рисунок 6

    Анализ экспрессии на микрочипах транскриптомов SF370-подобных и MGAS5005-подобных изолятов.Показаны значения log 2 кратного изменения средних уровней транскриптов основных хромосомных генов, которые значительно различаются (P <0,05, тест Стьюдента t с последующей поправкой на частоту ложных открытий для учета множественных сравнений). ), с как минимум 2-кратным изменением экспрессии между SF370-подобными и MGAS5005-подобными изолятами. Красные и синие точки данных относятся к наличию или отсутствию этих генов в горизонтально перенесенной области размером 36 т.п.н. соответственно

    Обсуждение

    В совокупности наши геномные, SNP, транскриптомные и белковые анализы показывают, что клональная замена была ключевым фактором, связанным с недавним увеличением частоты и тяжести инвазивных инфекций, вызванных серотипом M1 GAS.Генетически отличающийся клон серотипа M1, очевидно более подходящий, чем другие изоляты серотипа M1, появился в середине 1980-х годов и быстро стал доминирующим среди изолятов болезней [11, 12, 30]. Более того, наши совокупные данные предполагают, что четкая серия молекулярных изменений объясняет основные эволюционные события, которые привели к созданию нового клона M1, который сейчас широко распространен (рис. 7). В этом сценарии задействованы по крайней мере 3 молекулярных процесса: приобретение профагов, кодирующих предполагаемые или доказанные факторы вирулентности SpeA и ДНКазу SdaD2; реципрокная рекомбинация хромосомного сегмента, кодирующего 2 внеклеточных токсина; и накопление 1 или более мутаций, которые увеличивают экспрессию небольшого числа других хромосомных генов.Доказательством в пользу такого порядка событий является знание того, что speA2 и sdaD2 были идентифицированы в штаммах M1 GAS, выделенных в течение 1970-х годов (таблица 1 и неопубликованные данные авторов), и что приобретение M12-подобных 36 т.п.н. по всей видимости, произошло в середине 1980-х годов

    Рисунок 7

    Реконструкция событий молекулярной эволюции, которые привели к появлению большого количества клона группы A Streptococcus . Гипотеза учитывает данные, представленные здесь и в предыдущей работе [3, 11–13, 30, 41].Ключевые события включают приобретение профагов, кодирующих SpeA и SdaD2 (фактор вирулентности внеклеточной ДНКазы), и событие горизонтального переноса гена с участием хромосомной области размером 36 т.п.н., кодирующей стрептолизин O и NAD + -гликогидролазу. На основании почти идентичности в последовательности ДНК мы предполагаем, что штамм серотипа M12 служил донором этой хромосомной области. Все штаммы серотипа M1, содержащие аллель speA1 , были выделены до 1988 г., что позволяет предположить, что этот аллель является предком аллеля speA2 , характерного для изолятов M1 после 1988 г.Эти 2 аллеля отличаются заменой на 1 нуклеотид [3]

    Рисунок 7

    Реконструкция событий молекулярной эволюции, которые привели к появлению большого количества клона группы A Streptococcus . Гипотеза учитывает данные, представленные здесь и в предыдущей работе [3, 11–13, 30, 41]. Ключевые события включают приобретение профагов, кодирующих SpeA и SdaD2 (фактор вирулентности внеклеточной ДНКазы), и событие горизонтального переноса гена с участием хромосомной области размером 36 т.п.н., кодирующей стрептолизин O и NAD + -гликогидролазу.На основании почти идентичности в последовательности ДНК мы предполагаем, что штамм серотипа M12 служил донором этой хромосомной области. Все штаммы серотипа M1, содержащие аллель speA1 , были выделены до 1988 г., что позволяет предположить, что этот аллель является предком аллеля speA2 , характерного для изолятов M1 после 1988 г. Эти 2 аллеля отличаются на 1 нуклеотидную замену [3]

    Кодируемые профагом гены speA и sdaD2 связаны с подавляющим большинством современных изолятов генотипа M1 (таблица 1 и рисунок 1) [11, 12, 41] .Хотя точный вклад SpeA в заболевание на мышиных моделях GAS-инфекции неясен, продукция SpeA у людей в сочетании с его хорошо изученной суперантигенной активностью предполагает, что этот белок участвует в патогенезе GAS [17, 42–45]. Недавно мы обнаружили, что SdaD2 увеличивает вирулентность за счет усиления уклонения от врожденной иммунной системы, вероятно, за счет деградации внеклеточных ловушек нейтрофилов, структур, которые состоят из хроматина и белков гранул и высвобождаются из полиморфно-ядерных лейкоцитов [46]

    Хотя это ясно что латеральный перенос гена участвует в приобретении M12-подобной области размером 36 т.п.н., наши эксперименты здесь не затрагивают ответственный молекулярный механизм.Размер этого элемента и полилизогенная природа штаммов GAS позволяют нам придерживаться мнения, что перенос произошел за счет генерализованной трансдукции от штамма серотипа M12 к штамму серотипа M1. Эта гипотеза убедительно подтверждается наблюдением, что профаг ϕ5005.3, присутствующий в геноме штамма MGAS5005 серотипа M1, фактически идентичен профагу ϕ9429.3, присутствующему в геноме штамма серотипа M12, который был секвенирован (неопубликованные авторы data)

    Обнаружение того, что только 8 основных хромосомных генов дифференциально экспрессировались (≥2-кратно) между генетически репрезентативными изолятами старого и современного генотипа M1, было неожиданным (рисунок 6).Пять из 8 дифференциально экспрессируемых генов расположены в области 36 т.п.н., которая различает изоляты GAS серотипа M1 до и после 1988 г. (рис. 4), обеспечивая важные косвенные доказательства, подтверждающие, что это событие горизонтального переноса генов способствовало возникновению современного Клон M1. Повышенная транскрипция slo и nga в современных изолятах коррелирует с повышенными уровнями белка и активности, наблюдаемыми в супернатантах современных штаммов (рисунки 5 и 6)

    В принципе, различия в уровнях транскриптов генов между штаммами филогенетические линии 2 серотипа M1 могут быть объяснены полиморфизмами, которые влияют на активность промотора.Таким образом, мы сравнили последовательности промоторных областей 8 дифференциально экспрессируемых генов в штаммах MGAS5005 и SF370. Промоторные области -10 и -35 nusG (который кодирует предполагаемый транскрипционный антитерминационный белок NusG) и nga , описанные Kimoto et al. [47] в гомологичных генах группы C были использованы Streptococcus . Мы обнаружили, что и nusG , и nga имели 2 изменения нуклеотидов в спейсерной области, разделяющей промоторные последовательности -10 и -35.6 других дифференциально экспрессируемых генов имели идентичные предполагаемые регуляторные последовательности выше в штаммах SF370 и MGAS5005

    . Нуклеотидные полиморфизмы, расположенные в спейсерной области, могут изменять активность промотора [48, 49], подтверждая гипотезу о том, что увеличенное количество nusG и транскриптов nga , произведенных штаммами MGAS5005-подобной линии M1, обусловлено повышенной активностью промотора. Поскольку nga , M5005_Spy0140 и slo котранскрибируются [47], транскрипция всех 3 генов будет увеличиваться в штаммах, содержащих более сильный промотор nga , что согласуется с данными наших экспрессионных микрочипов (рисунок 6)

    Постулируется обратная связь между тяжестью заболевания и экспрессией SpeB изолятами современного генотипа M1 [50].Это повышает вероятность того, что увеличение тяжести инвазивных инфекций с середины 1980-х годов может быть частично связано с подавлением выработки SpeB современным клоном M1. Наши данные микроматрицы экспрессии были получены с клетками GAS, собранными во время экспоненциальной фазы, и возможно, что дополнительные гены, такие как speB , дифференциально экспрессируются во время стационарной фазы. Однако в этой связи отметим, что вестерн-иммуноблот-анализ SpeB в супернатантах культур в стационарной фазе не выявил единообразной разницы в уровне иммунореактивного SpeB между изолятами старого и современного генотипа M1 (данные не представлены)

    В заключение, наши результаты имеют значение для понимания молекулярных событий, которые лежат в основе появления других бактериальных клонов, которые являются высоковирулентными или имеют другие характерные фенотипы болезни.Наши результаты подчеркивают важность развертывания интегрированного анализа в масштабе всего генома в таких усилиях

    Благодарности

    Мы благодарим M. Gutacker за помощь в анализе однонуклеотидного полиморфизма; К. Пфлугофту за техническую помощь; С. Шелбурну за критические замечания; и Дж. Ричард, за помощь редактора

    Ссылки

    1.,,.

    Латеральный перенос генов и природа бактериальных инноваций

    ,

    Nature

    ,

    2000

    , vol.

    405

    (стр.

    299

    304

    ) 2 ..

    Патогенез стрептококковых инфекций группы А

    ,

    Clin Microbiol Rev

    ,

    2000

    , vol.

    13

    (стр.

    470

    511

    ) 3.,. .

    Возрождение стрептококковых заболеваний группы А с комментарием к синдрому стафилококкового токсического шока

    ,

    Возникающие инфекции

    ,

    1998

    Нью-Йорк

    Academic Press

    (стр.

    185

    218

    ) 4., , , и другие.

    Иммуногенетическая и молекулярная основа различий в исходах инвазивных стрептококковых инфекций группы А

    ,

    Nat Med

    ,

    2002

    , vol.

    8

    (стр.

    1398

    404

    ) 5.,,,.

    Эпидемиологические и клинические аспекты инвазивных стрептококковых инфекций группы А и синдрома токсического стрептококкового шока

    ,

    Clin Infect Dis

    ,

    1998

    , vol.

    27

    (стр.

    1428

    36

    ) 6.,,,,,.

    M изолятов стрептококков группы A, представленных в Национальный центр Streptococcus (Канада) с 1993 по 1999 г.

    ,

    J Clin Microbiol

    ,

    2002

    , vol.

    40

    (стр.

    4466

    71

    ) 7.,,, Et al.

    Инвазивная стрептококковая инфекция группы А в Атланте: популяционная оценка

    ,

    Clin Infect Dis

    ,

    1998

    , vol.

    27

    (стр.

    150

    7

    ) 8., , , и другие.

    Прогресс в характеристике метагенома группы A Streptococcus : полная последовательность генома штамма M6, устойчивого к макролидам, серотипа

    ,

    J Infect Dis

    ,

    2004

    , vol.

    190

    (стр.

    727

    38

    ) 9.,,, Et al.

    Геномная последовательность штамма серотипа M28 группы A Streptococcus: потенциальных новых сведений о послеродовом сепсисе и специфичности бактериальных заболеваний

    ,

    J Infect Dis

    ,

    2005

    , vol.

    192

    (стр.

    000

    00

    ) 10.,,, et al.

    Система анализа и обнаружения генома ERGO

    ,

    Nucleic Acids Res

    ,

    2003

    , vol.

    31

    (стр.

    164

    71

    ) 11.,,,,,.

    Streptococcus pyogenes , вызывающий синдром токсического шока и другие инвазивные заболевания: клональное разнообразие и экспрессия пирогенного экзотоксина

    ,

    Proc Natl Acad Sci USA

    ,

    1991

    , vol.

    88

    (стр.

    2668

    72

    ) 12.,,,,,.

    Генетическое разнообразие и взаимоотношения между Streptococcus pyogenes штаммами, экспрессирующими белок серотипа M1: недавнее межконтинентальное распространение субклона, вызывающего эпизоды инвазивного заболевания

    ,

    Infect Immun

    ,

    1995

    , vol.

    63

    (стр.

    994

    1003

    ) 13.,,, Et al.

    Быстрый отбор вариантов белка, ингибирующего комплемент, в группе A Streptococcus эпидемических волн

    ,

    Nat Med

    ,

    1999

    , vol.

    5

    (стр.

    924

    9

    ) 14.,,, Et al.

    Быстрое молекулярно-генетическое субтипирование серотипа M1 группы A Streptococcus штаммов

    ,

    Emerg Infect Dis

    ,

    1999

    , vol.

    5

    (стр.

    254

    63

    ) 15.,,, Et al.

    Распространение стрептококкового ингибитора вариантов комплемента при фарингите и инвазивных изолятах в эпидемии инфекции серотипа M1 группы A Streptococcus

    ,

    J Infect Dis

    ,

    2001

    , vol.

    183

    (стр.

    633

    9

    ) 16.,,,.

    Молекулярное сравнение стрептококков группы А серотипа T1M1 от инвазивных и неинвазивных инфекций в Финляндии

    ,

    J Infect Dis

    ,

    1997

    , vol.

    175

    (стр.

    392

    9

    ) 17.,,, Et al.

    Экспрессия гена Streptococcus группы A у людей и яванских макак с острым фарингитом

    ,

    Infect Immun

    ,

    2003

    , vol.

    71

    (стр.

    2199

    207

    ) 18.,,, Et al.

    Общегеномный защитный ответ, используемый Streptococcus группы A для избежания разрушения полиморфно-ядерными лейкоцитами человека

    ,

    Proc Natl Acad Sci USA

    ,

    2003

    , vol.

    100

    (стр.

    1996

    2001

    ) 19.,,, Et al.

    Внеклеточная дезоксирибонуклеаза, продуцируемая группой A Streptococcus , способствует патогенезу, усиливая уклонение от врожденного иммунного ответа

    ,

    Proc Natl Acad Sci USA

    ,

    2005

    , vol.

    102

    (стр.

    1679

    84

    ) 20.,,, Et al.

    Полная последовательность генома штамма M1 Streptococcus pyogenes

    ,

    Proc Natl Acad Sci USA

    ,

    2001

    , vol.

    98

    (стр.

    4658

    63

    ) 21.,,, Et al.

    Последовательность генома и сравнительный анализ микроматрицы серотипа M18 группы A Streptococcus штаммов, связанных со вспышками острой ревматической лихорадки

    ,

    Proc Natl Acad Sci USA

    ,

    2002

    , vol.

    99

    (стр.

    4668

    73

    ) 22.,,, Et al.

    Геномная последовательность штамма серотипа M3 группы A Streptococcus: фаго-кодируемых токсинов, фенотип с высокой вирулентностью и появление клона

    ,

    Proc Natl Acad Sci USA

    ,

    2002

    , vol.

    99

    (стр.

    10078

    83

    ) 23.,,,.

    Молекулярная эпидемиология nga и активность НАД гликогидролазы / АДФ-рибозилтрансферазы среди Streptococcus pyogenes , вызывающих синдром токсического шока стрептококка

    ,

    J Infect Dis

    ,

    2000

    , vol.

    182

    (стр.

    1117

    28

    ) 24.,,,,.

    Эволюционная геномика Staphylococcus aureus: понимание происхождения метициллин-устойчивых штаммов и эпидемии синдрома токсического шока

    ,

    Proc Natl Acad Sci USA

    ,

    2001

    , vol.

    98

    (стр.

    8821

    6

    ) 25.,,,.

    NAD + -гликогидролаза действует как внутриклеточный токсин для увеличения внеклеточной выживаемости стрептококков группы A

    ,

    Mol Microbiol

    ,

    2002

    , vol.

    44

    (стр.

    257

    69

    ) 26.,,,.

    Роль стрептолизина О в мышиной модели инвазивной стрептококковой болезни группы А

    ,

    Infect Immun

    ,

    2000

    , vol.

    68

    (стр.

    6384

    90

    ) 27.,,, Et al.

    Группа A Streptococcus Динамика транскриптома во время роста в крови человека раскрывает бактериальные стратегии адаптации и выживания

    ,

    Am J Pathol

    ,

    2005

    , vol.

    166

    (стр.

    455

    65

    ) 28.,,, Et al.

    Контроль вирулентности в группе A Streptococcus с помощью двухкомпонентной системы регуляции генов: глобальное профилирование экспрессии и моделирование инфекции in vivo

    ,

    Proc Natl Acad Sci USA

    ,

    2002

    , vol.

    99

    (стр.

    13855

    60

    ) 29.,,,.

    NPS @: Network Protein Sequence Analysis

    ,

    Trends Biochem Sci

    ,

    2000

    , vol.

    25

    (стр.

    147

    150

    ) 30.,,, И др.

    Клональная основа возобновления серьезного заболевания Streptococcus pyogenes в 1980-е годы

    ,

    Ланцет

    ,

    1992

    , vol.

    339

    (стр.

    518

    21

    ) 31.,,, Et al.

    Идентификация и характеристика гена scl , кодирующего фактор вирулентности внеклеточного белка группы A Streptococcus , сходный с человеческим коллагеном

    ,

    Infect Immun

    ,

    2000

    , vol.

    68

    (стр.

    6542

    53

    ) 32.,.

    Ген экзотоксина стрептококка типа А (эритрогенный токсин) находится в бактериофаге T12

    ,

    Infect Immun

    ,

    1984

    , vol.

    46

    (стр.

    531

    6

    ) 33.,,,.

    Постпротеомная идентификация новой кодируемой фагом стрептодорназы, Sda1, в инвазивном M1T1 Streptococcus pyogenes

    ,

    Mol Microbiol

    ,

    2004

    , vol.

    54

    (стр.

    184

    97

    ) 34.,,.

    Дифосфопиридиннуклеотидаза как внеклеточный продукт роста стрептококков и его возможная связь с лейкотоксичностью

    ,

    J Exp Med

    ,

    1957

    , vol.

    106

    (стр.

    27

    37

    ) 35.,.

    Ассоциация продукции дифосфопиридинуклеотидазы с серологическим типом группы А Streptococcus

    ,

    J Bacteriol

    ,

    1957

    , vol.

    74

    (стр.

    412

    3

    ) 36.,,,.

    Применение нового метода определения стрептококковой никотинамидадениндинуклеотидгликогидролазы к различным M-типам Streptococcus pyog enes

    ,

    J Clin Microbiol

    ,

    1976

    , vol.

    3

    (стр.

    533

    6

    ) 37.,,,,.

    Ген NAD ‐ гликогидролазы (nga) из Streptococcus pyogenes

    ,

    FEMS Microbiol Lett

    ,

    2000

    , vol.

    191

    (стр.

    235

    41

    ) 38.,,,,.

    NAD + -гликогидролазная продуктивность гемолитических стрептококков, определенная простым флуоресцентным методом, и ее связь с Т серотипом

    ,

    FEMS Microbiol Lett

    ,

    1995

    , vol.

    128

    (стр.

    289

    92

    ) 39.,.

    Сывороточное ингибирование стрептококковой дифосфопиридинуклеотидазы при неосложненном стрептококковом фарингите и ревматической лихорадке

    ,

    J Clin Invest

    ,

    1959

    , vol.

    38

    (стр.

    1942

    9

    ) 40.,,.

    Нейтрализующие антитела к стрептококковой дифосфопиридиннуклеотидазе в сыворотке экспериментальных животных и человека

    ,

    J Exp Med

    ,

    1958

    , vol.

    108

    (стр.

    299

    309

    ) 41.,,,,.

    Глобально распространенный субклон M1 стрептококков группы A отличается от других субклонов 70 килобазами профаговой ДНК и способностью к высокочастотной внутриклеточной инвазии

    ,

    Infect Immun

    ,

    1998

    , vol.

    66

    (стр.

    5592

    7

    ) 42.,,,.

    Молекулярный анализ роли пирогенного экзотоксина A стрептококка (SPEA) в инвазивной инфекции мягких тканей, вызванной Streptococcus pyogenes

    ,

    Mol Microbiol

    ,

    1999

    , vol.

    33

    (стр.

    778

    90

    ) 43.,,.

    Дополнение speA отрицательного Streptococcus pyogenes с speA: эффекты на вирулентность и продукцию стрептококкового пирогенного экзотоксина A

    ,

    Microb Pathog

    ,

    2001

    , vol.

    31

    (стр.

    109

    14

    ) 44.,,, Et al.

    Повышенная восприимчивость к суперантиген-ассоциированному стрептококковому сепсису у трансгенных мышей с лейкоцитарным антигеном и DQ

    ,

    J Infect Dis

    ,

    2001

    , vol.

    184

    (стр.

    166

    73

    ) 45.,,, Et al. Полиморфизм

    HLA класса II определяет ответы на бактериальные суперантигены

    ,

    J Immunol

    ,

    2004

    , vol.

    172

    (стр.

    1719

    26

    ) 46., , , и другие.

    Нейтрофильные внеклеточные ловушки убивают бактерии

    ,

    Science

    ,

    2004

    , vol.

    303

    (стр.

    1532

    5

    ) 47.,,,.

    Молекулярная характеристика оперона НАДаза-стрептолизин оперона гемолитических стрептококков

    ,

    Biochim Biophys Acta

    ,

    2005

    , vol.

    1681

    (стр.

    134

    49

    ) 48.,,,,.

    Мутантная спейсерная последовательность между -35 и -10 элементами делает промотор P lac гиперактивным и независимым от белка рецептора цАМФ

    ,

    Proc Natl Acad Sci USA

    ,

    2004

    , vol.

    101

    (стр.

    6911

    6

    ) 49.,.

    Мутации в области промоторного спейсера и области ранней транскрипции увеличивают экспрессию стафилококкового энтеротоксина A

    ,

    Infect Immun

    ,

    1993

    , vol.

    61

    (стр.

    5421

    5

    ) 50.,,,,.

    Обратная связь между тяжестью заболевания и экспрессией стрептококковой цистеиновой протеазы SpeB среди клональных изолятов M1T1, выделенных из случаев инвазивной стрептококковой инфекции группы A

    ,

    Infect Immun

    ,

    2000

    , vol.

    68

    (стр.

    6362

    9

    )

    © 2005 Американское общество инфекционных болезней

    Противораковая активность жидкости, обработанной газом, генерируемым микроволновой плазмой, посредством активации макрофагов

    Реактивные формы азота (RNS), включая оксид азота (NO ), были известны как одна из ключевых регуляторных молекул в иммунной системе. В этом исследовании мы генерировали воду, содержащую RNS, обработанную газом, генерируемым микроволновой плазмой, в котором основным компонентом был оксид азота (PGNO), и исследовали влияние на поляризацию макрофагов.Воду, содержащую RNS, разводили в полной среде для культивирования клеток (раствор PGNO) до концентрации, которая не вызывала гибели клеток в мышиных макрофагах RAW 264.7. Раствор PGNO усиливает активацию макрофагов M1-типа и подавляет характеристики макрофагов M2-типа на уровне транскрипции. Кроме того, обработанные раствором PGNO M2-подобные макрофаги обладали более высоким потенциалом в уничтожении клеток меланомы. Противораковый потенциал также исследовали на модели сингенных мышей. Наши результаты показывают, что раствор PGNO может преобразовывать судьбу макрофагов, предлагая лечение раствором PGNO в качестве поддерживающего метода для контроля функции макрофагов в микросреде опухоли.

    1. Введение

    Недавно плазменно-активированная вода (PAW) или среда (PAM) были представлены в качестве эффективного решения для уничтожения различных видов раковых клеток, включая рак яичников, рак шейки матки, рак поджелудочной железы и глиобластому [1– 6]. PAW или PAM имеет несколько преимуществ по сравнению с прямой плазменной обработкой. PAM не имеет никакой опасности поражения электрическим током, его можно хранить при низкой температуре в течение определенного периода, и его можно вводить в любую часть тела.Многие исследователи пытались понять механизмы действия PAM в его противоопухолевой активности. Поскольку ПАМ содержит относительно долгоживущие реактивные частицы по сравнению с прямой обработкой плазмой, ионы перекиси водорода и оксида азота были идентифицированы как основные участники реакционной способности ПАМ [7–16]. В биологических системах различают действие активных форм кислорода (АФК) и активных форм азота (РНС) [17]. Обычно АФК вызывает окислительный стресс, который обычно может активировать окислительно-восстановительные реакции в клетках; Между тем, RNS индуцирует нитрозилирование или нитрозирование, которое инициирует различные клеточные сигнальные пути, которые, как известно, связаны с дифференцировкой клеток или процессом заживления ран [18–20].В этом исследовании мы создали PAW, который в основном содержал RNS, и применили их к макрофагам врожденных иммунных клеток, чтобы изучить их поляризованную дифференцировку, особенно когда они взаимодействуют с раковыми клетками.

    Одним из важных факторов противоопухолевого лечения является микроокружение раковых тканей. Хорошо известно, что раковые клетки создают микроокружение, которое поддерживает их рост и подавляет противоопухолевую иммунную активность. Обычно он характеризуется низким содержанием кислорода, низким pH, высоким содержанием лактата, высоким RNS и т. Д., что приводит к дифференцированным ответам клеточных компонентов [21]. Моноциты, один из наиболее важных компонентов, рекрутируются в опухолевые ткани и поляризованы на поддерживающие опухоль макрофаги вместо хорошо известного воспалительного поляризованного M1 [22–24]. Их называют ассоциированными с опухолью макрофагами (ТАМ), которые относятся к альтернативной поляризации, которая просто называется поляризацией M2. Поскольку известно, что ТАМ стимулируют все аспекты инициации, роста и развития опухоли и влияют на противоопухолевую эффективность химиотерапии и лучевой терапии, преобразование ТАМ в макрофаги M1 является очень важным вопросом в терапии рака.

    Хотя сложный процесс программирования ТАМ еще не выяснен, известно, что иммунные ответы в опухолевых тканях определяются РНС, а также цитокинами, хемокинами или метаболитами [25–27]. РНС продемонстрировали как иммуносупрессивное, так и иммуноактивирующее действие в области опухоли при различных состояниях [27–29]. RNS в основном синтезируются индуцибельной синтазой оксида азота (iNOS) в ответ на внешние раздражители. Макрофаги M1 экспрессируют большое количество iNOS, вызывая апоптоз рака; однако экспрессия iNOS в ТАМ подавлялась в микроокружении опухоли, чтобы поддерживать низкую концентрацию NO , которая связана с ангиогенезом или метастазированием [25–29].Экспрессия iNOS тесно связана с поляризацией макрофагов, поэтому экспрессия iNOS в макрофагах используется в качестве маркера их противоопухолевой активности [24, 30].

    В этом исследовании мы создали воду, содержащую RNS, обработанную газом, генерируемым микроволновой плазмой, в котором основным компонентом был оксид азота (PGNO), и исследовали его влияние на противораковое действие макрофагов in vitro и in vivo [ 31–33]. Чистую воду обрабатывали PGNO, и воду разбавляли полной средой (PGNO-media) для исследования клеток.Исследовали пролиферацию, поляризацию и противораковую функцию макрофагов. Среди различных видов рака мы выбрали меланому, вид рака кожи, из-за простоты доступа, а также его злокачественности [34]. Сообщалось, что меланома также регулирует микросреду, позволяя макрофагам способствовать ангиогенезу и росту опухоли [35]. Линии мышиных клеток Макрофага Raw 264.7 и меланомы B16F10 использовали для исследования in vitro , а нормальных мышей C57BL / 6 использовали для исследования in vivo .C57BL / 6 имеет нормальные иммунные функции, и сингенные модели были созданы путем подкожной инъекции клеток B16F10. Для имитации ТАМ клетки макрофага Raw 264.7 предварительно обрабатывали интерлейкином-4 (IL-4) [36, 37]. Обсуждается влияние РНС-содержащих PAW на опухолевый иммунитет.

    2. Материалы и методы
    2.1. Микроволновая плазма, генерирующая PGNO

    На рисунке 1 (а) показана схема микроволновой плазмы, генерирующей PGNO. СВЧ-плазменный аппарат состоит из источника питания, магнетрона, волноводных элементов (WR-340 на 2.45 ГГц) и микроволновая плазменная горелка. Микроволновое излучение от магнетрона проходит через циркулятор, через измеритель мощности, через тюнер, который регулирует импеданс плазмы, и через горелку. Газообразный азот поступает в разрядную трубку в виде закрученного газа через питатель, что приводит к вихревому течению в разрядной трубке. Расход газа регулировался контроллером массового расхода, который поддерживает расход газа N 2 10,0 л в минуту и ​​газа O 2 0.4 л / мин. Подробная конструкция и принцип действия системы микроволнового плазмотрона описаны в предыдущих отчетах [31, 32]. Горелка запускается воспламенителем, и подается электрическая мощность 400 Вт. Нагретый газ от пламени горелки охлаждается до комнатной температуры, проходя через трубку водяного охлаждения, а затем охлажденный газ впрыскивается в 1 л деионизированной (DI) воды в течение 50 мин. Для уменьшения реакции охлажденного газа с растворенным в воде O 2 деионизированная вода продувается чистым газом N 2 в течение 1 часа перед зажиганием плазмы.Радикалы NO, генерируемые микроволновым плазменным устройством, растворяются в деионизированной воде и разбавляются средой для культивирования клеток (PGNO-media), как показано на рисунке 1 (b).

    2.2. Измерение pH, NO
    x и H 2 O 2 в PGNO-Media

    Концентрацию H 2 O 2 определяли с помощью реагентов Amplex red (A22188, Thermo Fisher Scientific) и концентрации и были измерены с помощью набора для колориметрического анализа оксида азота (K262-200, BioVision) в соответствии с протоколами производителя.Все измерения проводились в течение 5 мин после генерации PGNO-media и повторялись не менее трех раз. Интенсивность флуоресценции и изменение цвета измеряли с помощью планшет-ридера (Synergy HT, BioTek). PH измеряли с помощью pH-метра (Eutech Instruments, Сингапур).

    2.3. Клеточные культуры и анализы жизнеспособности

    Сырые клеточные линии мыши 264.7 и B16F10 были приобретены в корейском банке клеточных линий. Клетки культивировали в полной среде DMEM (LM001-05, Welgene), содержащей 10% фетальной бычьей сыворотки (FBS; Biowest) и 1% антибиотиков (LS203-01, Welgene).Клетки поддерживали в 5% CO 2 и увлажненном воздухе при 37 ° C. Для измерения влияния среды PGNO на жизнеспособность клеток клетки помещали в 96-луночные планшеты (SPL30096, SPL или 3610, Corning Inc.) с плотностью на лунку. Жизнеспособность клеток измеряли с использованием одного водного раствора для анализа пролиферации клеток CellTiter 96 (G3582, Promega) и люминесцентного раствора для анализа жизнеспособности клеток CellTiter-Glo (G7572, Promega) через 1, 2 и 3 дня после обработки PGNO-средой. Поглощение при 490 нм и люминесценцию измеряли с помощью планшет-ридера (Synergy HT, BioTek).Морфологию клеток наблюдали с помощью инвертированной микроскопии (Eclipse Ti-U, Nikon).

    2.4. Проточная цитометрия

    Для измерения внутриклеточного NO использовали DAF-FM DA (D23844, Thermo Fisher Scientific). Необработанные клетки 264,7 высевали в 6-луночный планшет с плотностью на лунку. Клетки инкубировали с 20 нг / мл IL-4 (рекомбинантный мышиный IL-4, R&D Systems) в течение 24 часов, и среду заменяли средой PGNO. После 24-часовой инкубации с PGNO-средой клетки окрашивали 10 мкл M DAF-FM DA в DPBS (LB001-02, Welgene) в течение 20 минут при 37 ° C.После 2-кратной промывки DPBS клетки инкубировали в среде еще 20 мин. Затем клетки отделяли, и флуоресцентный сигнал на клетку анализировали с помощью проточного цитометра (BD Verse, BD Biosciences). LPS (L4391, Sigma) использовали с концентрацией 10 нг / мл, SNAP (S-нитрозо-N-ацетил-D, L-пеницилламин; Sigmal) использовали с концентрацией 50 мкг M и cPTIO ( 2- (4-карбоксифенил) -4,5-дигидро-4,4,5,5-тетраметил-1H-имидазолил-1-окси-3-оксид, монокалиевая соль; Cayman) использовали с концентрацией 50 мкМ. М.

    Для окрашивания антителами, анти-iNOS-PE (12-5920-80, eBioscience), анти-CD163-PE (bs-2527R-PE, Bioss) и анти-CD86-FITC (bs-1035R-FITC, Bioss). Клетки фиксировали в 4% параформальдегиде при 4 ° C в течение 10 мин. После двухкратной промывки DPBS клетки проницались в 0,05% тритоне X-100 при комнатной температуре в течение 15 минут. После двукратной промывки DPBS клетки блокировали 1% BSA при 4 ° C в течение 1 часа. Затем их окрашивали антителами (1: 200) при 4 ° C в течение 1 часа. После трехкратной промывки DBPS флуоресценцию анализировали с помощью проточной цитометрии (BD Verse, BD Biosciences).

    Для анализа апоптоза использовали набор для обнаружения апоптоза Annexin V-FITC (BD 556547, BD Biosciences). После 24 ч инкубации с PGNO-средой клетки промывали холодным DPBS, ресуспендировали в 1x связывающем буфере и затем окрашивали аннексином V-FITC и иодидом пропидия (PI). После промывки 1х буфером для связывания клетки анализировали проточной цитометрией (BD Verse, BD Biosciences).

    Для окрашивания перитонеальных макрофагов использовали антитело Alexa Fluor 594 против CD11b мыши / человека (101254, BioLegend) и антитело против iNOS-PE мыши (12-5920-80, eBioscience).Перитонеальные макрофаги собирали из брюшной полости мыши и обрабатывали 1 мл буфера для лизиса эритроцитов при 4 ° C в течение 5 минут в течение двух раз. Клетки фиксировали в 4% параформальдегиде при 4 ° C в течение 10 мин. После двухкратной промывки DPBS клетки проницались в 0,05% тритоне X-100 при комнатной температуре в течение 15 минут. После двукратной промывки DPBS клетки блокировали 1% BSA при 4 ° C в течение 1 часа. Затем их окрашивали антителом CD11b (1: 200) при 4 ° C в течение 1 часа. После трехкратной промывки их окрашивали антителом iNOS (1: 200) при 4 ° C в течение 1 часа.После трехкратной промывки DBPS флуоресценцию анализировали с помощью проточной цитометрии (BD Verse, BD Biosciences).

    2,5. Измерение уровня транскрипции (кПЦР)

    Необработанные клетки 264,7 высевали в 6-луночный планшет с плотностью на лунку. Клетки инкубировали с 20 нг / мл мышиного IL-4 за 24 ч до стимуляции PGNO-media. После 24-часовой инкубации в среде PGNO клетки собирали и общую РНК экстрагировали с помощью набора RNeasy Mini Kit (Qiagen). Суммарные РНК были преобразованы в кДНК с использованием обратной транскриптазы и случайных праймеров (ReverTra Ace qPCR Master Mix, Toyobo) в соответствии с протоколом производителя.Такое же количество экстрагированной общей РНК, взятой из каждого образца, использовали для синтеза кДНК. Синтезированные кДНК использовали в ПЦР в реальном времени (CFX96TM Real-Time System, Bio-Rad). SYBR использовали для количественного определения количества дцДНК. Относительное количество экспрессии мРНК было нормализовано по GAPDH и выражено как кратное изменение по сравнению с контролем. Относительную экспрессию генов оценивали методом сравнительного порогового цикла. Эксперименты повторяли не менее трех раз. Последовательности праймеров следующие: NOS2 (F: 5-GTGGTGACAAGCACATTTGG, R: 5-AAGGCCAAACACAGCATACC), ARG-1 (F: 5CGCCTTTCTCAAAAGGACAG, R: 5GACATCAACTAAGGCCAGGTC: 5GACTCAACTAAGGCCAGGT), ILAGCAG-6 α + (F: 5TGTTGCCTCCTCTTTTGCTT, Р: 5TGGTCACCAAATCAGCGTTA), ИЛ-10 (F: 5CATGGGTCTTGGGAAGAGAA, Р: 5AACTGGCCACAGTTTTCAGG), CCL17 (F: 5ACATAAAACGGCCTGTGACC, Р: 5TTTGTGTTCGCCTGTAGTGC), ММР9 (F: 5AGGTGGACCATGAGGTGAAC, Р: 5CGGTTGAAGCAAAGAAGGAG), ЭФР ( F: GAACAAGAGGACTGGCCAAA, R: 5ATGGATGGACCACAACCAGT), VEGFA (F: 5CCAGGAGGACCTTGTGTGAT, R: 5GGGAAGGGAAGATGAGGAAG) и GAPDH (F: 5TAGAACATCATCCCTGGACAC).

    2.6. Вестерн-блоттинг

    Клетки промывали DPBS, лизировали лизисным буфером RIPA (GenDepot, Barker, TX), содержащим 1% коктейля 100x ингибиторов протеазы (GenDepot, Barker, TX), и инкубировали в течение 30 минут на льду. Лизаты центрифугировали при 19000 g в течение 30 мин при 4 ° C, супернатант смешивали с 25% 4-кратного денатурирующего буфера (100 мМ трис-HCl, pH 6,8, 4% SDS и 20% глицерин с бромфеноловым синим) и нагревали. на 5 мин. Белки разделяли через 10% гели SDS-PAGE и переносили на нитроцеллюлозную мембрану с помощью Mini Trans-Blot Cell (Bio-Rad, CA).Мембрану блокировали 5% BSA в TBS, содержащем 0,1% Tween 20 (TBS-T), в течение 1 ч и инкубировали в течение ночи с намеченными антителами в 3% BSA. Затем избыток первичных антител удаляли 3-кратной промывкой TBS-T. Затем мембрану инкубировали с вторичными антителами, конъюгированными с HRP (0,1 мкг мкг / мл, антикроличьи) в течение 1 часа. После трех промывок TBS-T полосы визуализировали с помощью вестерн-блоттинга и экспонировали на рентгеновской пленке или с помощью ChemiDoc Imaging Systems (Bio-Rad). Исходные изображения пленки поддерживаются на рис.S1 и S2 (вспомогательная информация).

    2.7. Совместное культивирование B16F10 и сырых клеток 264.7

    Для совместного культивирования Raw 264.7 с раковыми клетками в 24-луночном планшете (37024, SPL) использовали вставку из поликарбоната с порами 0,4 мкм в диаметре м. Необработанные клетки 264,7 культивировали на вставной мембране с плотностью на лунку, а B16F10 культивировали в нижнем 24-луночном планшете с плотностью на лунку отдельно. Когда клетки были полностью прикреплены, клетки обращались друг к другу с 500 мкл л и 700 мк л средами для вставки и планшета с лунками, соответственно.Некоторые из Raw 264.7 клеток предварительно обрабатывали 20 нг / мл IL-4 за 24 часа до воздействия 1/10 PGNO-среды, где PGNO-вода разбавлялась 1/10 полной средой.

    2,8. Подкожное введение PAW мышам

    Двенадцать мышей C57BL / 6 были приобретены у OrientBio в Корее. Животных кормили стерильной и коммерческой диетой для мышей, и им давали воду ad libitum . Эксперименты на животных были одобрены Комитетом по институциональным исследованиям и этике Университета Квангун (номер разрешения: KWU-PBRC1701004).Все эксперименты на животных проводились в соответствии с соответствующими инструкциями и правилами. B16F10 в концентрации клеток / мл вводили подкожно в правую сторону спины мышей [38]. Семь дней спустя мышиную шерсть сбрили для наблюдения. Затем 1 мл 1/10 PGNO-media или 1x DPBS вводили подкожно рядом с местом инъекции раковых клеток каждый день в течение следующих 12 дней. Вес тела измеряли каждый день (рис. S3, вспомогательная информация).После 12 дней лечения мышей умерщвляли газом CO 2 и собирали ткани опухоли. Были измерены ширина, длина и высота опухолевых тканей, и объем ткани был рассчитан путем умножения этих значений. Наконец, трижды собирали перитонеальные макрофаги с DPBS lush. Всего 6 мл ледяного DPBS вливали в брюшную полость и втягивали шприцем. Собранный раствор центрифугировали, и осажденные клетки анализировали для дальнейшего анализа.

    2.9. Статистический анализ

    Статистическую значимость определяли с использованием непарного критерия Стьюдента (двухсторонний, равное стандартное отклонение). Считается статистически значимым, когда и (,; †,). Средние значения и стандартные ошибки были рассчитаны и нанесены на графики. Анализ был выполнен с использованием Microsoft Excel.

    3. Результаты
    3.1. Свойства PGNO-Media

    На рисунке 1 (а) показана схема микроволнового плазмотрона, который был разработан для генерации радикалов NO , когда газовая смесь N 2 и O 2 подавалась в зону разряда.Согласно предыдущим отчетам, мы пропускали через разрядную зону 10 л / мин газа N 2 и 0,4 л / мин газа O 2 , а плазма охлаждалась во время прохождения через трубки водяного охлаждения [32]. Наконец, NO , содержащий газ из микроволновой плазмы, пропускали через 1 л деионизированной (DI) воды в течение 50 минут, которую предварительно продували газом N 2 в течение 1 часа для удаления растворенных молекул кислорода. Концентрация NO в этой воде была определена электрохимическим методом и составила 117 мк M, и она была названа PGNO-водой [33].Чтобы оценить биологические эффекты PAW, мы разводили PAW в среде для культивирования клеток, как показано на рисунке 1 (b), и измеряли долгоживущие реактивные виды, H 2 O 2 и в течение 30 минут после генерации. Измеренная концентрация общего NO × составляла примерно 340 мкл М в растворе, разбавленном 1/10. Большинство из них были в форме, в то время как около 5% были. Концентрация H 2 O 2 была очень низкой и практически не обнаруживалась. Первоначально pH PGNO-воды составлял 2.8, но в буферизованном PGNO-носителе значение стало 7,4. На рис. 1 (b) в таблице приведены характеристики 1/10 PGNO-среды, предназначенной для клеточных исследований.

    3.2. Жизнеспособность клеток макрофагов после стимуляции PGNO-Media

    Цитотоксические эффекты PGNO-media на макрофаги Raw 264.7 оценивали путем измерения митохондриальной активности и количества внутриклеточного АТФ. На рисунках 2 (а) и 2 (b) показано каждое измерение за 3 дня, которое было выражено относительно контроля каждого дня.Оба значения были увеличены в сильно разбавленной среде PGNO, в то время как оба были уменьшены в слегка разбавленной среде PGNO. Эти данные подтверждают, что разведение более чем в 20 раз не было токсичным и даже увеличивало жизнеспособность клеток. Цитотоксичность PGNO-среды была снова подтверждена окрашиванием аннексином V и PI (йодид пропидия) через 24 часа инкубации в PGNO-среде. На рис. 2 (с) показаны данные проточной цитометрии, ось которых представляет собой интенсивность флуоресценции аннексина-V, а ось — интенсивность флуоресценции PI.Большинство клеток были нанесены в нижнюю левую область, что подтверждает, что PGNO-среда, разведенная более чем в 10 раз, не индуцирует апоптоз в макрофагах. Интересно отметить, что соотношение некротических и апоптотических клеток в среде PGNO несколько снизилось, как показано на усредненных гистограммах четырех повторяющихся экспериментов. По-видимому, разбавленная более чем в 10 раз среда PGNO не вызывала апоптоза, хотя немного снижала метаболическую активность. В следующих исследованиях мы использовали те же факторы разведения, чтобы изучить влияние PGNO-media на физиологию макрофагов.

    3.3. Морфологические изменения макрофагов в PGNO-Media

    PGNO-media вызывали морфологические изменения и вариации размеров макрофагов. На рисунке 3 (а) показаны контрастированные по фазе изображения в ярком поле клеток Raw 264.7, которые инкубировали в среде PGNO в течение 24 часов. Некоторые круглые макрофаги становились фибробластами при стимуляции PGNO-средой. Морфологические изменения были подтверждены статистически с помощью проточной цитометрии. На рисунке 3 (b) показаны графики интенсивности света прямого рассеяния (FSC) и бокового рассеяния (SSC) клеток в каждой группе.Понятно, что соотношение красных пятен увеличилось, тогда как средние значения FSC и SSC были выше. Увеличение значения FSC означает увеличение размера ячеек, а увеличение SSC означает увеличение шероховатости поверхности или внутренней зернистости. Данные представлены в виде гистограмм на фиг. 3 (c) и 3 (d), которые показывают, что средние значения FSC и SSC макрофагов увеличивались вместе с коэффициентом разбавления. Эти данные предполагают, что PGNO-media индуцировала морфологические изменения и изменение размера макрофагов.Чтобы имитировать ТАМ, клетки предварительно обрабатывали ИЛ-4 в течение 24 часов, а среду меняли на среду PGNO, LPS (липополисахариды) или среду для культивирования клеток. На рис. 3 (е) показаны изображения фазового контраста в светлом поле предварительно обработанных IL-4 клеток. По сравнению с маленькими и круглыми контрольными клетками, обработанные ИЛ-4 клетки стали более плоскими и удлиненными. Клетки, обработанные PGNO-media, не вызывали больше морфологических изменений, чем LPS, которые вызывали серьезные деформации клеток.

    3.4. Повышение внутриклеточного NO
    внутри макрофага в PGNO-Media

    Внутриклеточный NO интенсивно изучается как основной индикатор и важный фактор активации макрофагов [20].Внутриклеточный NO окрашивали DAFFMDA, и интенсивность флуоресценции на клетку измеряли с помощью проточной цитометрии через 24 часа инкубации с PGNO-средой. Чтобы проверить внутриклеточное увеличение NO в поляризованных макрофагах, таких как ТАМ, клетки Raw 264.7 предварительно инкубировали с IL-4 в течение 24 часов. На Фигуре 3 (f) показаны средние интенсивности флуоресценции (MFI) на клетку, которые были выражены как относительные значения к контролю. Значение первого столбца значительно ниже, чем в контроле, что представляет собой значительное снижение внутриклеточного NO, когда макрофаги инкубировали с IL-4.Однако очевидно, что PGNO-media увеличивает количество внутриклеточного NO в М2-подобных макрофагах, обработанных IL-4. Изменение внутриклеточного NO может быть связано с экспрессией iNOS, которая является регуляторной молекулой в поляризации макрофагов. Эти изменения во внутриклеточном NO , а также в морфологии клеток предполагают возможные регуляторные эффекты наших PGNO-сред на активацию макрофагов. Чтобы подтвердить, были ли повышенные значения внутриклеточным NO , мы использовали хорошо известный скавенджер NO (cPTIO) и хорошо известный донор NO (SNAP).Уровень внутриклеточного NO увеличивался при добавлении SNAP, как и в случае PGNO-media, и уровни снижались при добавлении cPTIO до уровней, аналогичных контролю.

    3.5. Действие PGNO-Media на реполяризацию M2-подобных макрофагов

    Чтобы изучить влияние PGNO-media на поляризацию M2-подобных макрофагов, мы проанализировали уровни экспрессии M1- или M2-связанных белков в уровнях мРНК в Макрофаги, предварительно обработанные IL-4, после 24 ч инкубации в среде PGNO.Экспрессия мРНК белков, связанных с поляризацией M1, таких как iNOS и IL-6, увеличивалась в соответствии с фактором разведения PGNO-media, но увеличение TNF-α не было значительным (рис. 4 (а)). С другой стороны, экспрессия мРНК белков, связанных с поляризацией M2, таких как ARG1, IL-10, TGF- β , CCL17, EGF и MMP9, была в основном значительно снижена (рис. 4 (b)). Экспрессию iNOS дополнительно исследовали на уровне белка. На рис. 4 (c) показана повышающая регуляция iNOS в макрофагах, предварительно обработанных IL-4, на уровне трансляции.Экспрессию маркерных белков M1 или M2 анализировали с помощью проточной цитометрии (рис. 4 (d)). Графики показывают повышенную регуляцию iNOS и Cd86 (маркеры поляризации M1) и небольшое подавление Cd163 (маркер поляризации M2). Эти результаты подразумевают, что PGNO-media может быть способным ограничивать транскрипцию генов, связанных с M2, и вызывать поляризацию макрофагов M1 [22].

    3.6. Противоопухолевые эффекты макрофагов, стимулированных PGNO-средой in vitro

    Для проверки противоопухолевых эффектов макрофагов, активированных PGNO-средой, макрофаги совместно культивировали в непрямом контакте с клетками меланомы мыши B16F10, как показано на фиг. 5 (a).Клетки B16F10 совместно культивировали с предварительно обработанными или необработанными IL-4 макрофагами в системе трансвелл с размером пор 0,4 мкм и размером пор мкм. Цитотоксическое иммунное действие макрофагов было проанализировано путем измерения внутриклеточного АТФ клеток меланомы после 24 часов совместного культивирования (рис. 5 (b)). Значения были выражены относительно монокультурных контрольных клеток. Совместное культивирование рака с макрофагами значительно снизило значения АТФ раковых клеток во всех случаях. Когда добавляли PGNO-media, снижение стало более значительным, особенно когда макрофаги были предварительно обработаны IL-4.Это было подтверждено анализом проникновения красителя PI, который показывает соотношение мертвых клеток, как показано на Фигуре 5 (c). Соотношение мертвых клеток увеличивалось при добавлении PGNO-среды, особенно когда макрофаги были предварительно обработаны IL-4. Это совместное исследование предполагает, что PGNO-media усиливают цитотоксичность макрофагов за счет активации секреции цитокинов.

    3,7. Противораковые эффекты макрофагов, стимулированных PGNO-средой, in vivo

    Противораковые эффекты PGNO-среды исследовали на сингенной модели меланомы на мышах.На рисунке 6 (а) показана простая схема эксперимента на животных. Мышей, которым вводили DPBS, использовали в качестве фиктивного контроля, и во время экспериментов в течение 19 дней не было мертвых мышей. На Фигуре 6 (b) показаны 6 мышей фиктивной группы и 6 мышей экспериментальной группы после ежедневного введения DPBS или PGNO-media вблизи меланомы в течение 12 дней, соответственно. Стрелки на каждом изображении указывают положение опухоли. Очевидно, что размеры опухолей были значительно меньше при использовании PGNO-media по сравнению с обработкой DPBS.На рисунке 6 (c) показаны опухолевые ткани, извлеченные у мышей, в порядке, показанном на рисунке 6 (b). Были измерены ширина, длина и высота опухолевых тканей, и на Рисунке 6 (d) приведены объемы в таблице. Среднее значение было меньше более чем в два раза. Когда был удален самый большой в группе DPBS, разница все равно была более чем в два раза. Это показывает тенденцию к замедлению роста опухоли с помощью PGNO-media. Хотя мы не могли измерить точную скорость роста опухоли с самого начала, фотографии, сделанные на 7, 10 и 11 дни, которые показали скорость роста опухолей, а также их размеры, сильно различались в двух группах (рис.S3 вспомогательная информация).

    Чтобы оценить влияние PGNO-media на активацию макрофагов во время роста опухоли in vivo , мы собрали опухолевые ткани и проанализировали их экспрессию iNOS и Arg1. Из-за небольших размеров некоторых тканей мы использовали 6 образцов из группы, обработанной PBS, и 4 образца из группы, обработанной PGNO-media. На рисунке 7 (a) показаны изображения вестерн-блоттинга, а на рисунке 7 (b) показаны количественные значения интенсивности по отношению к белку актина. Уровни экспрессии белка существенно не отличались друг от друга.Кроме того, перитонеальные макрофаги собирали после умерщвления и окрашивали антителами к CD11b и iNOS. На Фигуре 7 (c) показан 2D график перитонеальных макрофагов, окрашенных CD11b и iNOS, где CD11b-положительные клетки отмечены красными квадратами. На Фигуре 7 (d) показана повышенная флуоресценция iNOS клеток CD11b + от мышей, которым вводили PGNO-media. Эти данные предполагают, что при введении PGNO-media во время роста опухоли перитонеальные макрофаги экспрессировали больше белков iNOS.

    4.Обсуждения

    Прежде всего, мы успешно сгенерировали PGNO-носитель, содержащий исключительно RNS. Колориметрический анализ показал, что наши среды PGNO в основном содержат RNS и не содержат ROS, таких как H 2 O 2 . Поскольку вся наша система генерации PGNO была изолирована от атмосферной среды, компоненты среды PGNO контролировались исключительно входящими газами, N 2 и O 2 в этом исследовании. Горячие реакционноспособные частицы генерировались сфокусированным микроволновым излучением, но первичные частицы охлаждались с помощью системы охлаждения, чтобы получить более стабильные химические соединения, такие как NO и NO 2 .Следовательно, химические частицы, которые были очищены в деионизированной воде, не содержали свободных электронов для генерации атомов OH или O / H, что, возможно, приводило к генерации ROS. Ожидаемые химические реакции были предложены в предыдущем отчете [31]. Кроме того, мы предполагаем, что эти RNS имеют долгий срок службы, потому что вода PGNO образовалась после очистки воды от растворенного кислорода. Время жизни NO в водном растворе составляет около нескольких минут и уменьшается с увеличением концентрации O 2 в окружающей среде [39–41].Время полужизни NO в нашей PGNO-воде было измерено электрохимически в течение примерно 6 часов, и NO полностью не погиб через 16 часов после образования PGNO [33]. Чтобы подтвердить вид, измеренный электрохимическим методом в нашей PGNO-воде, мы попробовали другие методы, такие как ЭПР с MGC (N- (дитиокарбамоил) -N-метил-D-глюкамин, натриевая соль, Dojindo Molecular Technologies, Inc.) и спектроскопический анализ с молекулами гемоглобина после предыдущего сообщения [42]. Мы обнаружили радикальные формы при измерении ЭПР и окисления гемоглобина при спектроскопии (данные здесь не приводятся).Однако сигналы отличались от контрольного эксперимента с хорошо известным донором NO SNAP. Хотя молекулярная форма еще точно не изучена, мы можем предположить, что эти реактивные радикалы азота, а также NO x могут реагировать с биомолекулами в среде, вызывая каскадные процессы в биологических системах.

    Известно, что действие РНС на биологические системы зависит от их концентрации [43, 44]. NO в низкой концентрации может активировать функцию клеток, инициируя сигнальные пути цГМФ, но в высокой концентрации он может вызывать гибель клеток, высвобождая цитохром C из митохондрий [43, 44].В предыдущем сообщении было показано, что радикалы NO в PAW также увеличивают рост клеток в низких концентрациях и становятся фунгицидными в высоких концентрациях [45]. В случае PGNO-media мы обнаружили, что разведение в диапазоне от 1/1280 до 1/20 нетоксично и активирует метаболическую активность макрофагов. Даже разведение 1/10 не вызывает апоптоза, хотя немного снижает метаболическую активность. Рисунки 2 и 3 показывают, что потенциал PGNO-media для активации макрофагов может быть увеличен, если он был менее разбавлен.Основываясь на данных in vitro , мы использовали 1/10 PGNO-среду в совместных культурах или исследованиях на животных, чтобы добавить метаболическую токсичность для раковых клеток, а также вызвать провоспалительные ответы от M2-поляризованных макрофагов. Однако в исследовании сокультивирования мы обнаружили, что 1/10 PGNO-media вообще не снижает метаболическую активность клеток B16F10. Это означает, что чувствительность к PGNO-media различается в зависимости от типа клеток. Основываясь на этом клеточном исследовании, мы можем предположить, что уменьшение размера опухоли в экспериментах на мышах было связано с модуляцией иммунной системы, а не с прямой цитотоксичностью PGNO-media на клетки меланомы.Результаты вестерн-блоттинга опухолевых тканей и анализа проточной цитометрии перитонеальных макрофагов подтверждают, что 1/10 PGNO-media может модулировать иммунную активность всего организма [46]. Мы предполагаем, что RNS внутри PGNO-media играет роль в модуляции поляризации макрофагов.

    На протяжении десятилетий было проведено множество испытаний по подавлению функции ТАМ и их превращению в M1-поляризованные клетки [25]. Введение донора NO NOC-18 или M1 активировало макрофаги с образованием высокой концентрации NO / RNS в опухолевых тканях модели почечно-клеточной карциномы мыши, что могло ослабить рост опухоли, но не могло вызвать дегенерацию опухоли [47, 48].Макрофаги, отделенные от пациента со злокачественной мезотелиомой, были активированы M1 in vitro и переданы обратно хозяину. Хотя высокий уровень TNF- α был продуцирован в опухолях и размер опухоли был уменьшен, инъецированные макрофаги вернулись к M2-подобному режиму в опухолях за счет секреции противовоспалительных цитокинов и липидных медиаторов в микроокружении опухоли [49 –51]. Таким образом, поддержание активации M1 макрофагов в опухолевых тканях было указано в качестве решения.

    Наши экспериментальные данные подтверждают, что стимуляция PGNO-media может ограничивать функцию ТАМ-подобных макрофагов и преобразовывать их функцию в M1-подобные макрофаги. Известно, что IL-4 индуцирует поляризацию M2, индуцируя нисходящие пути, такие как фосфорилирование STAT6 и экспрессию IRF4 [35, 36]. Обработка PGNO-media для IL-4-индуцированных M2-подобных макрофагов приводила к положительной и отрицательной регуляции M1- и M2-связанных генов, соответственно. Обработка PGNO-media in vivo также приводила к ингибированию роста опухоли и усилению экспрессии iNOS в перитонеальных макрофагах.Наше исследование показывает, что PGNO-media негативно регулирует опосредованные опухолью манипуляции с макрофагами. Кроме того, следует отметить, что действие PGNO-media на активацию макрофагов и противораковую активность не было линейно дозозависимым, как метаболическая активность и уровень внутриклеточного NO (Фигуры 2 и 3). Кривые уровня транскрипции Cd86 (рисунок 4 (d)), а также уровня цитотоксичности опухоли (рисунок 5 (c)) показали некоторые оптимальные диапазоны доз для активации M2-подобных макрофагов.Это дало бы дополнительную информацию об этих процессах, поскольку это указывает на двойной способ действия.

    Наши данные предлагают нового донора RNS, который может поддерживать M1-подобную активацию TAM. Поскольку среда PGNO состоит исключительно из RNS, не остается никаких химикатов или неожиданных побочных продуктов. Кроме того, существует вероятность того, что PGNO-media может усиливать иммунную активность всего организма, как показано на фиг. 7. Это может быть полезно для пациентов, страдающих низкой иммунной активностью из-за введения противоопухолевых лекарств.Мы считаем, что наши эксперименты предоставляют возможность применения PGNO-media в противоопухолевой терапии для замедления роста опухоли, а также для активации врожденной иммунной активности. Однако следует провести дальнейшие исследования с использованием первичных макрофагов вместо линии клеток Raw 264.7, полученных от лейкемических мышей, для подтверждения действия PGNO-media на клетки врожденного иммунитета. Кроме того, необходимо исследовать ассоциированные с опухолью макрофаги вместо перитонеальных макрофагов, чтобы понять прямое влияние PGNO-media на микроокружение опухолей.

    Доступность данных

    Данные, использованные для подтверждения выводов этого исследования, можно получить у соответствующего автора по запросу.

    Конфликт интересов

    Авторы заявляют об отсутствии потенциальных конфликтов интересов в отношении авторства и / или публикации этой статьи.

    Вклад авторов

    Чэ Бок Ли и Иль Хван Со внесли равный вклад в эту работу.

    Выражение признательности

    Это исследование было поддержано Программой найма ведущих зарубежных исследовательских институтов через Национальный исследовательский фонд Кореи (NRF), финансируемой правительством Кореи (MSIP) (NRF-2016K1A4A3

    3), и исследовательским грантом Университета Квангун в 2017 году. .

    Дополнительные материалы

    Рисунок S1: исходное изображение пленки на Рисунке 4 (c). Чтобы уменьшить количество антител, мы разрезали мембрану для переноса белка в месте, соответствующем размеру целевого белка. Каждую разрезанную мембрану реагировали со специфическими антителами, а затем инкубировали с хемилюминесцентным раствором. Они были размещены и закреплены на кассете. Рентгеновская пленка прореагировала с ними четыре раза, а затем проявилась в темноте. (а) Исходное изображение фильма.Для данных были выбраны прямоугольники красного цвета. (б) Изображение на пленке. (c) Полоса 130 кДа была использована для iNOS, а полоса 42 кДа была использована для β -актина. Рисунок S2: исходные изображения пленки с рисунка 7 (а). После окрашивания антителами изображения пленки получали с помощью аппарата ChemiDoc (Bio-Rad). (а) Изображения, полученные ChemiDoc. Слева направо изображение представляет собой хемилюминесцентное, колориметрическое и композиционное изображение HRP соответственно. (b) Для данных были выбраны прямоугольники красного цвета.Рисунок S3: ежедневно измеряемый вес и фотографии, сделанные на 7-й и 10-й день экспериментальных мышей (а). Фотографии мышей, сделанные на 7, 10 и 11 день. Поскольку мы использовали нормальных мышей с шерстью, было трудно измерить опухоль без жертв. Чтобы приблизительно оценить размер опухоли, были сделаны фотографии под наркозом. Размеры опухолевых тканей измеряли в конце эксперимента после умерщвления, и данные помещали в текст. (b) Вес мышей измеряли ежедневно. Хотя мы не могли измерять размер опухоли ежедневно, мы измеряли вес животных.Поскольку оно проводилось без анестезии, было довольно много ошибок. Единицы измерения — грамм (гистограмма). (Дополнительные материалы)

    Изготовление PVDF-мембраны с заданной морфологией и свойствами путем изучения и расчета ее тройной фазовой диаграммы для приложений очистки сточных вод и разделения газов

    Мы сообщаем о простом подходе к изменению морфологии мембран из поливинилиденфторида (ПВДФ), изготовленных с использованием метода разделения фаз без использования растворителей (NIPS), который поддерживает как гидрофильные, так и гидрофобные свойства.Различные мембранные структуры, , то есть слоев кожи, а также целые мембранные структуры, были получены с помощью экспериментальным методом, основанным на полученной и рассчитанной тройной фазовой диаграмме. Взаимодействие нерастворителей с раствором полимера привело к различным формам и свойствам поверхностного слоя изготовленных мембран, которые влияли на общий перенос молекул растворителя и нерастворителей внутри и снаружи объема изготовленных мембран. Полученная морфология и свойства были подтверждены с использованием методов 3D-оптического профилометра, SEM, FT-IR и XRD.Влияние параметров бинарного взаимодействия на морфологию изготовленных мембран и на их характеристики разделения было протестировано с использованием смеси вода / масло и разделения газов. Как гидрофобные, так и гидрофильные свойства ПВДФ продемонстрировали отличные долговечные характеристики разделения подготовленных мембран с 92% отделения масла и максимальным потоком 395 л ч -1 м -2 наряду с 120 мин длительного -временная стабильность. Для дополнительной поддержки эффекта настроенных мембран из ПВДФ с различными / Наноструктурированные морфологии.Газовые характеристики продемонстрировали сверхвысокую проницаемость и в несколько раз больше, чем коэффициент разделения Кнудсена. Результаты демонстрируют, что простой и недорогой подход может быть успешно применен к настройке мембран из ПВДФ для прогнозирования и проектирования конечной структуры мембраны.

    Эта статья в открытом доступе

    Подождите, пока мы загрузим ваш контент… Что-то пошло не так.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    2019 © Все права защищены. Карта сайта